intTypePromotion=1
zunia.vn Tuyển sinh 2024 dành cho Gen-Z zunia.vn zunia.vn
ADSENSE
 » 
 » 

Báo cáo y học: " Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission"

Chia sẻ: Nguyễn Minh Thắng Thắng | Ngày: | Loại File: PDF | Số trang:17

Thêm vào BST
Báo xấu
68
lượt xem 1
download
 
  Download Vui lòng tải xuống để xem tài liệu đầy đủ

Tuyển tập các báo cáo nghiên cứu về y học được đăng trên tạp chí y học quốc tế cung cấp cho các bạn kiến thức về ngành y đề tài: Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: Báo cáo y học: " Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission"

  1. Retrovirology BioMed Central Open Access Research Conservation of functional domains and limited heterogeneity of HIV-1 reverse transcriptase gene following vertical transmission Vasudha Sundaravaradan, Tobias Hahn and Nafees Ahmad* Address: Department of Microbiology and Immunology, College of Medicine, The University of Arizona Health Sciences Center, Tucson, Arizona 85724, USA Email: Vasudha Sundaravaradan - vasudha@email.arizona.edu; Tobias Hahn - tobias@email.arizona.edu; Nafees Ahmad* - nafees@u.arizona.edu * Corresponding author Published: 26 May 2005 Received: 18 February 2005 Accepted: 26 May 2005 Retrovirology 2005, 2:36 doi:10.1186/1742-4690-2-36 This article is available from: http://www.retrovirology.com/content/2/1/36 © 2005 Sundaravaradan et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The reverse transcriptase (RT) enzyme of human immunodeficiency virus type 1 (HIV-1) plays a crucial role in the life cycle of the virus by converting the single stranded RNA genome into double stranded DNA that integrates into the host chromosome. In addition, RT is also responsible for the generation of mutations throughout the viral genome, including in its own sequences and is thus responsible for the generation of quasi-species in HIV-1-infected individuals. We therefore characterized the molecular properties of RT, including the conservation of functional motifs, degree of genetic diversity, and evolutionary dynamics from five mother-infant pairs following vertical transmission. Results: The RT open reading frame was maintained with a frequency of 87.2% in five mother- infant pairs' sequences following vertical transmission. There was a low degree of viral heterogeneity and estimates of genetic diversity in mother-infant pairs' sequences. Both mothers and infants RT sequences were under positive selection pressure, as determined by the ratios of non-synonymous to synonymous substitutions. Phylogenetic analysis of 132 mother-infant RT sequences revealed distinct clusters for each mother-infant pair, suggesting that the epidemiologically linked mother-infant pairs were evolutionarily closer to each other as compared with epidemiologically unlinked mother-infant pairs. The functional domains of RT which are responsible for reverse transcription, DNA polymerization and RNase H activity were mostly conserved in the RT sequences analyzed in this study. Specifically, the active sites and domains required for primer binding, template binding, primer and template positioning and nucleotide recruitment were conserved in all mother-infant pairs' sequences. Conclusion: The maintenance of an intact RT open reading frame, conservation of functional domains for RT activity, preservation of several amino acid motifs in epidemiologically linked mother-infant pairs, and a low degree of genetic variability following vertical transmission is consistent with an indispensable role of RT in HIV-1 replication in infected mother-infant pairs. virus type 1 (HIV-1) accounts for more than 90% of all Background The vertical transmission of human immunodeficiency HIV-1 infections in children. HIV-1 infected pregnant Page 1 of 17 (page number not for citation purposes)
  2. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 women can transmit the virus to their infants during all with palm, finger and thumb subdomains [21-23] that are stages of their pregnancy, including prepartum (trans-pla- connected to the RNase H by the "connexion" subdomain cental passage), intrapartum (exposure of infants' skin [22,24,25]. Each domain has several secondary structural and mucous membranes to contaminated maternal blood elements which are critical for primer binding, template and vaginal secretions) and post-partum (via breast milk) binding [14,22,23,26,27] and nucleotide recruitment at an estimated rate of 30% [1-4]. However, the rate of ver- [28]. More specifically, the aspartate residues at position tical transmission can be reduced by antiretroviral therapy 110, 185 and 186 are believed to be the active sites of the during pregnancy. The risk of vertical transmission polymerase and are located in the palm subdomain at the increases with several parameters, including advanced bottom of the DNA binding cleft [14,16,20,28,29]. Muta- maternal disease status, low maternal CD4 cell count, tions in this subdomain and the active site abolish the high maternal viral load, recent infection of the mother, enzymatic activity of HIV-1 RT [2,19,22,30-32] and alter prolonged exposure of infant to ruptured membranes dur- viral replication, which may also affect HIV-1 mother-to- ing parturition, and higher viral heterogeneity in the infant transmission. mother [5-8]. In this study, we characterized the HIV-1 RT quasi-species Viral heterogeneity is one of the classical means by which from five mother-infant pairs following vertical transmis- HIV-1 evades the host immune system. The heterogeneity sion, including a mother with infected twin infants. We of HIV-1 is attributed to the error-prone reverse tran- show that the open reading frame of the RT gene was scriptase (RT) enzyme, which is responsible for converting highly conserved in the sequences from five mother- the single stranded viral genomic RNA to double-stranded infant pairs. In addition, there was a low degree of heter- DNA that integrates into the host chromosome. As reverse ogeneity and high conservation of functional domains transcription is the first step of the viral replication cycle essential for RT activity. These findings may be helpful in [9], errors made at this stage ensures propagation of the the understanding of the molecular mechanisms of HIV-1 erroneously copied genome to form the quasi-species of vertical transmission. HIV-1 found in the infected individuals. These quasi-spe- cies infect other uninfected target cells and the cycle of Results error-prone reverse transcription continues. We have pre- Patient population and sample collection viously demonstrated that HIV-1 sequences from trans- Blood samples were collected from five HIV-1-infected mitting mothers (mothers who transmitted HIV-1 to their mother-infant pairs following perinatal transmission, infants) were more heterogeneous compared with HIV-1 including samples from a set of twins (IH1 and IH2) in sequences from non-transmitting mothers (mothers who the case of mother H. The demographic, clinical and lab- failed to transmit HIV-1 to their infants) [10]. This finding oratory findings on these mother-infant pairs are summa- further suggests that the reverse transcription step that is rized in Table 1. The Human Subjects Committee of the responsible for generation of viral heterogeneity, may also University of Arizona, and the Institutional Review Board play an important role in vertical transmission. The RT of the Children's Hospital Medical Centre, Cincinnati gene is unique in that it is also exposed to the same mutat- Ohio, approved this study. Written informed consent was ing effects of the RT enzyme as other part of the HIV-1 obtained for participation in the study from mothers of genome. Therefore, we sought to examine HIV-1 RT infected mother-infant pairs. sequences from five infected mother-infant pairs follow- ing perinatal transmission. Phylogenetic analysis of RT sequences of mother-infant isolates The HIV-1 RT shows significant sequence and structural We first performed multiple independent polymerase similarity to other viral reverse transcriptases as well as chain reaction (PCR) amplifications from peripheral viral and bacterial RNA polymerases [11-13]. HIV-1 RT is mononuclear cells (PBMC) DNA of five mother-infant a heterodimeric protein comprising of two subunits, 66 pairs and obtained 10 to 14 clones from each patient fol- kDa and 51 kDa. It is encoded as a Gag-Pol precursor, lowed by nucleotide sequencing of these clones. We then Pr160gag-pol, which is cleaved by viral protease to yield the performed the phylogenetic analysis by constructing a Gag protein and the viral polymerase which codes for RT neighbor-joining tree of the 132 RT sequences from these [9,14]. The larger subunit (p66) of the heterodimer acts as mother-infant pairs, including the set of twins from an RNA-dependant DNA polymerase, a DNA-dependant mother H and the reference strain NL4-3, as shown in Fig- DNA polymerase and has RNase H activity associated ure 1. A model of evolution was optimized for the entire with the C-terminus [15,16], whereas the p51 subunit nucleotide sequence data set using the approach outlined lacks the C-terminus RNase H activity, is folded differently by Huelsenbeck and Crandall [33]. The model of choice from the p66 subunit and is thus inactive [17-20]. The was incorporated into PAUP [34] to estimate a neighbor- p66 is folded to form a structure similar to a right hand joining tree and the tree was bootstrapped 1000 times to Page 2 of 17 (page number not for citation purposes)
  3. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Table 1: Demographic, Clinical, and Laboratory Parameters of HIV-1 Infected Mother-Infant Pairs Length of infection a Clinical Evaluation b Patient Age Sex CD4+ cells/mm3 Antiviral drug MB 28 yr 509 11 mo None Asymptomatic IB 4.75 mo M 1942 4.75 mo None Asymptomatic, P1A MC 23 yr 818 1 yr6 mo None Asymptomatic IC 14 mo F 772 14 mo ZDV Symptomatic AIDS;P2A,D1,3,F MD 31 yr 480 2 yr6 mo None Asymptomatic ddCc ID 28 mo M 46 28 mo Symptomatic AIDS, P2AB,F; failed ZDV therapy MF 23 yr 692 2 yr10 mo None Asymptomatic IF 1 wk M 2953 1 wk ZDV Asymptomatic,P1A MH 33 yr 538 5 mo None Asymptomatic IHT1 7 mo F 3157 7 mo ACTG152 Hepatosplenomeglay lymphadenopathy IHT2 7 mo F 2176 7 mo ACTG152 Hepatosplenomegaly lymphadenopathy M: mother; I: infant. aLength of infection: The closest time of infection that we could document was the first positive HIV-1 serology date or the first visit of the patient to the AIDS treatment Center, where all the HIV-1 positive patients were referred to as soon as an HIV-1 test was positive. Therefore, these dates may not reflect the exact dates of infection. b Evaluation for infants is based on CDC criteria, cddC, Zalcitibine ensure fidelity. The phylogenetic tree demonstrated that sequences in 1680 bp sequenced. Moreover, the infected the RT sequences from five mother-infant pairs were well mothers' sequences showed a frequency of 85.5% of discriminated in separate clusters and that the mother and intact RT ORF while infants demonstrated a frequency of infant sequences were generally separated in distinct sub- 88.5%. Several clones in mother-infant pair B and mother clusters. However, there was some intermingling between H were found to be defective due to a single nucleotide mother and infant sequences in pair C. Furthermore, the substitution, insertion or deletion resulting either in formation of separate subclusters of RT sequences from frame-shift or stop codons. The RT sequences also dis- twins of mother H suggests that the there was probably played patient and pair specific amino acid sequence pat- compartmentalization of HIV-1 in the two fetuses causing terns. Several amino acid motifs changes were observed in independent evolution. We also compared our mother- majority of the mother-infant pairs' sequences, including infant pairs' RT sequences with the RT sequences of several a glutamic acid (E) or proline (P) at position 122, an clades present in the HIV databases and found that our RT arginine (R) at 277, and a threonine (T) or serine (S) at sequences grouped with clade or subtype B sequences 376 and 400. (not shown). The data on phylogenetic analysis indicate that the epidemiologically linked mother-infant Variability of RT gene sequences in mother-infant isolates sequences are closer to each other than epidemiologically The degree of genetic variability of RT sequences, meas- unlinked sequences and that there was no PCR cross con- ured as nucleotide and amino acid distances based on tamination. It is important to note that the mother-infant pairwise comparison (as described in Methods), was pairs grouped in the same subtree, even when some of the determined for the five mother-infant pairs' sequences, infants' ages were more than 2 to 3 years, suggesting that and is shown in Table 2. The nucleotide sequences of RT the epidemiological relationships are maintained in within mothers (mothers B, C, D, F and H) differed by mother-infant pairs no matter how long the infection in 0.80, 1.76, 1.37, 1.21 and 2.90% (median values), respec- the infants has progressed. tively, ranging from 0 to 3.46%. The variability in the infant sets (infants B, C, D, F, H1 and H2) was similar to the mother sequences and differed by 0.80, 1.49, 1.37, Coding potential of RT gene sequences The multiple sequence alignments of the deduced amino 1.31, 0.64 and 1.24% (median values), respectively, rang- acid sequences of HIV-1 RT genes from five mother-infant ing from 0 to 2.21%. Interestingly, the variability between pairs, B, C, D, F, mother H and her twin infants IH1 and epidemiologically linked mother and infant sets (pairs B, IH2 are shown in Figures 2, 3, 4, 5, 6, and 7, respectively. C, D, F and H) was also on the same order of 1.05, 1.7. These sequences were aligned with consensus subtype B 1.74, 1.22 and 1.45 (median values) respectively, ranging RT sequence (CON B). We found that 115 of the 132 from 0 to 4.48%. Moreover, the amino acid sequence var- sequences analyzed contained a complete RT open read- iability of RT within mothers (mothers B, C, D, F and H) ing frame (ORF), with an 87.2% frequency of intact RT differed by 1.26, 2.81, 1.98, 1.26 and 2.27% (median val- open reading frames thus indicating that the coding ues), respectively, ranging from 0 to 5.51%. The variabil- potential of the RT ORF was maintained in most of the ity within infants (infants B, C, D, F, H1 and H2) differed Page 3 of 17 (page number not for citation purposes)
  4. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 hivnl43 mb.1 mb.12 mb.4 mb.5 mb.8 mb.11 mb.2 mb.6 mb.3 mb.7 100 mb.9 ib.1 ib.7 ib.2 ib.3 Pair B ib.4 ib.5 ib.6 ib.8 ib.9 ib.10 ib.11 ib.12 mb.10 mc.1 mc.2 mc.3 ic.7 ic.8 ic.10 ic.11 ic.12 100 ic.13 ic.9 mc.4 mc.5 Pair C mc.6 mc.7 mc.8 ic.4 ic.1 ic.2 ic.3 mc.9 mc.10 mc.11 mc.12 ic.5 ic.6 mf.1 mf.2 61 mf.5 mf.9 mf.13 mf.11 mf.3 mf.4 100 mf.6 mf.7 Pair F mf.8 mf.10 mf.14 if.1 if.2 if.3 if.4 if.5 if.6 if.7 if.8 if.9 if.10 if.11 if.12 mh.1 mh.2 mh.8 mh.9 mh.14 mh.13 mh.5 mh.11 mh.12 mh.10 mh.3 mh.4 mh.6 mh.7 ih1.1 ih1.2 ih1.3 ih1.11 ih1.4 100 ih1.5 ih1.9 Pair H ih1.6 ih1.7 ih1.8 ih1.10 ih2.1 ih2.2 ih2.9 ih2.3 ih2.6 ih2.4 ih2.5 ih2.7 ih2.8 ih2.10 ih2.11 md.1 md.2 md.3 md.4 md.5 md.6 md.7 md.11 Pair D 100 md.8 md.9 md.10 id.1 id.2 id.3 id.4 id.5 id.6 id.10 id.7 id.8 id.9 0.005 substitutions/site Phylogenetic analysis of HIV-1 RT of 132 RT sequences from five mother-infant pairs, including B, C, D, F and H Figure 1 Phylogenetic analysis of HIV-1 RT of 132 RT sequences from five mother-infant pairs, including B, C, D, F and H. The neighbor- joining tree is based on the distance calculated between the nucleotide sequences from the five mother-infant pairs. Each ter- minal node represents one RT gene sequence. The numbers on the branch points indicate the percent occurrence of branches over 1,000 bootstrap resamplings of the data set. The sequences from each mother formed distinct clusters and are well dis- criminated and in confined subtrees, indicating that the variants from the same mother-infant pair are closer to each other than to other sequences and that there was no PCR cross-contamination. These data were strongly supported by the high boot- strap values indicated on the branch points. Page 4 of 17 (page number not for citation purposes)
  5. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Finger Palm Template grip (73-90) D110 CTL epitope Active site 1 50 110 150 187 CON B PISPIETVPV KLKPGMDGPK VKQWPLTEEK IKALVEICTE MEKEGKISKI GPENPYNTPV FAIKKKDSTK WRKLVDFREL NKRTQDFWEV QLGIPHPAGL KKKKSVTVLD VGDAYFSVPL DKDFRKYTAF TIPSINNETP GIRYQYNVLP QGWKGSPAIF QSSMTKILEP FRKQNPDIVI YQYMDDL MB.1 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .G........ ....... MB.2 .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... MB.3 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... E......... .......... .EN..R.... .......... .......... .......... .......... .......... ....... MB.4 .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... MB.5 .....A.... .......... ........D. .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .........S .......... .......... ....... MB.6 .....D.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... MB.7 .....A.... .......... A.HMAIDRR. ....A..... .......... .......... .......... .......... .......... .......... .......... A......... .EN....... .......... .......... .......... .......... .......... ....... MB.8 .....D.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... MB.9 .....D.... .......... .......... .......... .......... .........A .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... MB.10 .......... .......... .......... .......... .......... ...D...... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... MB.11 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... MB.12 .......... .......... .......... .......... .......... .......... .......G.. .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... IB.1 .....D.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... ......D... .......... .......... .......L.. ....... IB.2 .....D.... .......... ......I... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... IB.3 .....D.... .......... .......... .......... .......... .......... .......... .......... ......S... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... IB.4 .....AP... .......... .......... .......... V....R.... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .........L .......... .......... ....... IB.5 .....DP... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... IB.6 .....D.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .........L .......... .......... ....... IB.7 .....D.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... IB.8 .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......A.. .......... .......... .......... ....... IB.9 .....A.... .......... .......... .......... TG........ .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... IB.10 .....DP... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... IB.11 .....D.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... IB.12 .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EN....... .......... .......... .......... .......... .......... ....... Thumb Connection Template and primer binding helices αH αI Primer grip(227-235) 188 250 300 374 CON B YVGSDLEIGQ HRTKIEELRQ HLLRWGFTTP DKKHQKEPPF LWMGYELHPD KWTVQPIVLP EKDSWTVNDI QKLVGKLNWA SQIYAGIKVK QLCKLLRGTK ALTEVIPLTE EAELELAENR EILKEPVHGV YYDPSKDLIA EIQKQGQGQW TYQIYQEPFK NLKTGKYARM RGAHTNDVKQ LTEAVQK MB.1 .......... .........K ......L... .......... .......... .......A.. .......... .......D.. ..V.P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... .....R. MB.2 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... ........D. ...R...... .......... ......Y... .......... .......... .......... ....... MB.3 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... D......... .......... ....... MB.4 ......G... .........K ......L... .......... .......... .......... ........E. .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... MB.5 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...R.. .......... ......Y... .......... .......... .......... ....... MB.6 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... MB.7 .......... .........K ......L... .......... .......... .......... .......... .......... ...SP..... ......G... .......... G......... ...R...... .......... ......Y... .......... .......... .......... ....... MB.8 .......... .........K ......L... .E........ .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .........V .......... ....... MB.9 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... MB.10 .......... .........K ......L... .......... .......... .......... .......... .....R.... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... MB.11 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... MB.12 .......... .........K ......L... .......... .......... .......A.. .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... IB.1 .......... ........TK ......L... .......... .......... .......... ......G... .......... ...SP..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......I.. ....... IB.2 .......... .........K ......L... .......... .......... .......... .......... .......... ...FP..... .......... .......PNR RSRARAGRKQ RDS.RTSTWS VLX.I.R.NS RNTEA.VRPM DISNLSRAIX KSENR.ICKN E.C....... ....... IB.3 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... IB.4 ......V... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... IB.5 .......... .........K ......L... .......... .......... .......... .......... .......... ....P.T... .......... .......... .......... ...R...... .......... ......Y... .......... .......... ...--------------- IB.6 .......... ......G..K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... IB.7 .......... .........K ..V...L... .......... .......... .......... ......GH.. .......... ...SP..... .......... .......... .......... ...R..A... .......... ......Y... .......... .......... .......... ....... IB.8 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... IB.9 .......... .........K ......L... .......... ..T....... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... IB.10 .......... .........K ......L... ..N....... .......... .......... .......... .......D.. ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... IB.11 .......... .........K ......L... .......... .......... .......... .......... .......... ....P..... .......... .......... ..GP...... ...R...... .......... ......Y... .......... .......... .......... ....... IB.12 .......... ........GK ....X.L... .......... .......... .......... .......... .......... ....P..... .......... .......... .......... ...R...... .......... ......Y... .......... .......... .......... ....... Connection RNase H RNase H Active sites D443 E478 D498 D549 ↓ ↓ ↓ ↓ 375 455 505 560 CON B IATESIVIWG KTPKFKLPIQ KETWEAWWTE YWQATWIPEW EFVNTPPLVK LWYQLEKEPI VGAETFYVDG AANRETKLGK AGYVTDRGRQ KVVPLTDTTN QKTELQAIHL ALQDSGLEVN IVTDSQYALG IIQAQPDKSE SELVSQIIEQ LIKKEKVYLA WVPAHKGIGG NEQVDKLVSA GIRKVL MB.1 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... MB.2 .SM....... .......... .....T..ID .......... .......... .......... A...A.F... .......... .......... .......... .......... .......G.. .......... .......... ..I.N..... .V........ .......... .......... ...... MB.3 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ MB.4 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... MB.5 .SM....... ......S... .....T..ID .......... .......... .......... A.....F... .......... .........X .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... MB.6 .SM....... .......... .....T..ID .......... .......... .........V A.....F..R G......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... MB.7 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... MB.8 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .........R .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... MB.9 .SM....... .......... .....T..ID .......... .......... .......... A.....F... ....G..... .......... .......... .......... .......... .......... ..P......G ..I.HP...P MV........ ...T...... ....N..... E..... MB.10 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... MB.11 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... MB.12 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... ..S....... .......... .......... .......... .......... .......... .GI.N..... .V........ .......... .......... ...... IB.1 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... ...A...... ...... IB.2 .SM....... .......... .....T..ID .......... .......... .......... A.....F... ..Y....... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... IB.3 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... IB.4 .SM....... .......... .....T..ID .......... .......... .S........ A.....F... ......R... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... IB.5 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ IB.6 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.NR.... .V........ .......... .......... ...... IB.7 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V......P. .......... .......... ...... IB.8 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...R.. IB.9 .SM....... .......... .....T..ID .......... .......... .......... A.....F... ..D....... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... IB.10 .SM....... .......... .....T..ID .X........ .......... .......... A.....F... .......... .......... .......... .......... .......... .......... ...T.....G ..I.N..... .V........ .......... D......... ...... IB.11 .SM....... .A........ .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... IB.12 .SM....... .......... .....T..ID .......... .......... .......... A.....F... .......... .......... .......... .......... .......... .......... .......... ..I.N..... .V........ .......... .......... ...... Multiple2 verticalalignment of deduced amino acids of HIV-1 reverse transcriptase (RT) gene from mother-infant pair B Figure in involved sequence transmission Multiple sequence alignment of deduced amino acids of HIV-1 reverse transcriptase (RT) gene from mother-infant pair B involved in vertical transmission. In the alignment, the top sequence is the consensus RT sequence of subtype or clade B (CON B) to which mother-infant pair-B RT sequences are aligned. In mother-infant pair B sequences, each line refers to a clone iden- tified by a clone number with M referring to mothers and I referring to infants. The structural elements of RT are indicated above the alignment. Dots represent amino acid agreement with CON-B and substitutions are shown by single letter codes for the changed amino acid. Stop codons are shown as x and dashes represent gaps or truncated protein. Relevant amino acid motifs and domains essential for RT activity are shown by spanning arrowheads indicated above the alignment. by 1.44, 2.35, 1.80, 1.62, 1.44 and 1.62% (median val- sequences than epidemiologically unlinked individuals, ues), ranging from 0 to 4.57%, and between mother- suggesting that epidemiologically linked mother-infant infant pairs (pairs B, C, D, F and H) by 1.44, 2.90, 2.53, pair sequences are closer to each other. 1.44 and 2.17% (median values), ranging from 0 to 6.47%, respectively. We also determined sequence varia- We also investigated if the low variability of RT sequences bility between epidemiologically unlinked individuals seen in our mother-infant pair isolates is due to errors and found that the nucleotide distances ranged from 0 to made by LA Taq polymerase used in our study. We did not 9.1% (median 5.4%) and amino acid from 0 to 12.4% find any errors made by the LA Taq polymerase when we (median 6.34%). The variability in general was lower used a known sequence of HIV-1 NL 4–3 for PCR ampli- between epidemiologically linked mother-infant pairs' fication and DNA sequencing of the RT gene. Page 5 of 17 (page number not for citation purposes)
  6. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Finger Palm Template grip (73-90) D110 CTL epitope Active site 1 50 110 150 187 CON B PISPIETVPV KLKPGMDGPK VKQWPLTEEK IKALVEICTE MEKEGKISKI GPENPYNTPV FAIKKKDSTK WRKLVDFREL NKRTQDFWEV QLGIPHPAGL KKKKSVTVLD VGDAYFSVPL DKDFRKYTAF TIPSINNETP GIRYQYNVLP QGWKGSPAIF QSSMTKILEP FRKQNPDIVI YQYMDDL MC.1 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... HE........ .......... .......... ........T. .......... ......E... .....E. MC.2 .......... .......... .......... .......... L......... .......... ......N..R .......... .......... .......... Q......... .......... HE........ .......... .......... .......... .......... ..E...E... ....... MC.3 .......... .......... .......... .......... L......... .......... ......N..R .......... .......... .......... Q......... .......... HE........ .......... .......... .......... .......... ......E... ....... MC.4 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... ....H..... HE........ .......... .......... .......... .....I.... ......E... ....... MC.5 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... HE........ .......... .......... .......... .....I.... ......E... ....... MC.6 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... HE........ .......... .......... .......... .....I.... ......E... ....... MC.7 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .R........ .......... HE........ .......... .......... .......... .....I.... ......E... ....... MC.8 .......... .......... ..R....... .......... .....E.... .......... .......... .......... .......... .......... .......... .......... HE........ .......... .......... .......... .....I.... ......EV.. ....... MC.9 .......... .......... ...R...... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... HE........ .......... .......... .......... .......... ......E... ....... MC.10 .......... .......... .......... .......... .......L.. .......... .........R .......... ..K....... .......... .......... .......... HE........ .......... .......... .......... .......... ......E... ....... MC.11 .......... .......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... HE........ .......... .......... .......... ..N....... ..E...E... ....... MC.12 .......... .......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... ..V....... HEG....... ..L....... .......... .......... .......... ......E... ....... IC.1 .......... .......... .......... .......... .......... ...D...... .......... .......... .......... .......... .......... .........S HE........ .......... .......... .........S .S...I.... ......E... ....... IC.2 .......... .......... .......... .......... .......... .......... .......... .......... .......R.. .......... .......... .......... HE........ .......... .......... .......... .....I.... ......E... ....... IC.3 .......... .......... .......... .......... .......... .......... ..V....... .......... .......... .......... .......... .......... HE........ .......... .......... .......... .....I.... ......E... ....... IC.4 .......... .......... .......... .......R.. .......... .......... .......... .......... .......... .......... .......... .......... HE........ .......... .......... .......... ....I.... ......E... ....... IC.5 .....K.... .......... .......... .......... .......... .......... .......... .......... .......... R......... .......... .......... HE........ .......... .......... .......... .C...I.... ......E... ....... IC.6 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... HE........ .......... .......... .......... .C........ ......E... ....... IC.7 .......... .......... .......... .......... L......... .......... ......N..R .......... .......... .......... Q......... .......... HE........ .......... .......... .......... .C........ Y.....E... ....... IC.8 .......... .......... .......... .......... L....R.... .......... ......N..R .......... .......... .......... Q..-------------------------------------------------------------------------------------------- IC.9 .......... .......... .......... .......... L......... .......... ......N..R .......... ...A...... .......... Q......... .......... HE........ .......... .......... .......... .C........ ......E... ....... IC.10 .......... .......... .......... .......... .......... .......... ......N..R .......... .......... .......... Q......... A......... HE........ .......... .......... .......... .C........ ......E... ....... IC.11 .......... .......... .......K.. .......... .......... .......... ......N..R .......... .......... .......... Q......... ....H..... HE........ .......... .......... .......... .C........ ......E... ....G.. IC.12 .......... .......... .......K.. .......... .......... .......... ......N..R .......... .......... .......... Q......... .......... HE....H... .......... .......... .......... .C........ ......E... ....... IC.13 .......... .......... .......... .......... .......... .......... ......N..R .......... .......... .......... Q......... .......... HE........ .......... .......... .......... .C..A..... ......E... ....G.. Thumb Connection Template and primer binding helices αH αI Primer grip(227-235) 188 250 300 374 CON B YVGSDLEIGQ HRTKIEELRQ HLLRWGFTTP DKKHQKEPPF LWMGYELHPD KWTVQPIVLP EKDSWTVNDI QKLVGKLNWA SQIYAGIKVK QLCKLLRGTK ALTEVIPLTE EAELELAENR EILKEPVHGV YYDPSKDLIA EIQKQGQGQW TYQIYQEPFK NLKTGKYARM RGAHTNDVKQ LTEAVQK MC.1 .......... .......... .......... .......... .......... .......... N......... .......... ....P....R .....I.... .......... .......... .......... .......... .......... .......... .......... .......... ....... MC.2 .......... .......... .......... .Q.......S F......... ....P..... N......... .......... ....P....R .......... .....V.... .......... .......... .......... .......... .......... .........T .......... ....... MC.3 .......... .......... .......... .Q........ .....D.... .......... N......H.. .......... ....P....R .......... ..P..V.... ..G....... .......... .......... .......... .......... .......... .......... ....... MC.4 .......... ......G... .......... .......... .......... .......... N......... .......... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MC.5 .......... .......... .......... .......... .......... .......... N......... P......... ....P....R .......... .......... .......... .......... .......... G......... .......... .......... .......... ....... MC.6 .......... .......... .......... .......... .......... .......... N......... .......... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MC.7 .......... .......... .......... .......... .....G.... .......... N......... .......... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... ....A..... ....... MC.8 H..P...... .......... .......... .E..R..... .......... ..A....... N......H.. .......D.. ....P....R .......... .........K .......... .........A .......... .......... .......... .......... .......... ....... MC.9 .......... ..A....... .......... .......... .......... .......... N......... .......... ....P....R .......... .......... .......... G......... .......... .......... .......... D......... .......... ....... MC.10 .......... .......... .......... .....N.... .......... .......... N......H.. P......... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MC.11 .......... .......... .......... .......... .......... .......... N......... ..V....... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MC.12 .......... ..I....... .....R.... .......... .......... .......E.. N......... .......... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IC.1 .......... .......... .......... .......... .......... .......... N......... .......... ....P....R .......... .......... .......... .......... .......... .....V.... .......... .......... .......... ....... IC.2 .......... .......... .......... .......... .......... .......... NQ........ .......... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IC.3 .......... .......... .......... ..E....... .......... .......... N......... .......... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IC.4 .......... .......... .......... .......... .......... ..A....... N....A.... .......... ....P....R .......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IC.5 .......... .......... .......... .......... .......... .......... N......... .......... ....P....R .S........ .....V.... .......... .......... .......... .......... .......... ...P...... .......... ....... IC.6 ........R. .......... .......... .......... .......... .......... N......... .......... ....P....R .......... .....V.... .........G .......... .......... .......... .......... .......... .......... ....... IC.7 .......... .......... .......... .Q........ .......... .......... N......... .......... ....P....R .......... .....V.... .......... .......... .......... .......... .......... .......... .......... ....... IC.8 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ IC.9 .......... .......... .......... .......... .......... .....S.... N......... .......... ....P....R ..Y....... .......... .......... .......... .......... .......... .......... .......... .......... ....... IC.10 .......... .......... .......... .Q........ .......... .......... N......... .......... ....P....R .......... .....V.... D......... .......... .......... .......... .......... .......... ..V....... ....... IC.11 .......... .......... .......... .Q........ .......... .......... N......... .......... ....P....R .......... .....V.... .......... ....G..... .......... .......... .......... .......... .......... ....... IC.12 .......... .......... .......... .Q........ .......... .......... N...R..... .......... ....P....R .......... .....V.... .......... .......... ...S...... .......... .......... .......... .......... ....... IC.13 .......... .......... ....G..... .R........ ....C..... .......... N...X..... .......... ....P....R .......... .....V.... .......... .......... .......... .....R.... .......... .......... .......... ....... RNase H Connection RNase H active sites D443 E478 D498 D549 ↓ ↓ ↓ ↓ 375 455 505 560 CON B IATESIVIWG KTPKFKLPIQ KETWEAWWTE YWQATWIPEW EFVNTPPLVK LWYQLEKEPI VGAETFYVDG AANRETKLGK AGYVTDRGRQ KVVPLTDTTN QKTELQAIHL ALQDSGLEVN IVTDSQYALG IIQAQPDKSE SELVSQIIEQ LIKKEKVYLA WVPAHKGIGG NEQVDKLVSA GIRKVL MC.1 .S....I... .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .......... .......... .......... .......... .......... .......... .........T .....T.... .........S ...... MC.2 .S........ R....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .......... .......... .......... .......... .......... .......... .........T .....T.... .........S ...... MC.3 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... ......N... .......... .......... .......... .......... .......... ...R.....T .....T.... ..P.N....S ...... MC.4 .S........ .....R...N .....S...D ......T... .......... .......... L.....C... .......... ...I...... .I........ .......... .......... .......... .......... .......... .........T .......... .........S ...... MC.5 .S........ .....R...N .....S...D .......... .......... .......... L.....C... .......... ...I...... .I........ .......... .......... .......... .......... .......... .........T .......... .........S ...... MC.6 .S........ R....R...N E....S..AD .......... .......... .......... L.....C... .......... ...I...... .I........ .......... .......... .......... .......... .......... .........T .......... .........S ...... MC.7 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .I........ .......... .......... .......... .......... .......... .........T .......... .........P ...... MC.8 .S........ .....R...N .....S...D ....A..... .......... .......... L.....C... .......... ...I...... .I........ .......... .......... .......... .......... .......... ......I..T .......... .........S ...... MC.9 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I....G. .......... .......... .......... .......... .......... .......... .........S .......... .........S ...... MC.10 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .......... ...G...... .......... .......... .......... .Q........ .........T .......... ..R…...S ...... MC.11 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .......... .......... .......... .......... .......... .Q........ .........T ...T...... .........F ...... MC.12 .S........ R....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .......... .......... .......... .......... .......... .Q.......R .........T .......... .........F ...... IC.1 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .I........ .......... .......... .......... .......... .......... .........T .......... .........S ...... IC.2 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .I........ .......... .......... .......... .......... .......... .M.......T .......... .........S ...... IC.3 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .I........ .......... .......... .......... .......... .......... .M.......T .......... .........S ...... IC.4 .S........ .....R...N .....S...D .......... .......... .......... L.....C... .......... ...I...... .I........ .......... .......... .......... .......... ......V..R .........T .......... .........S ...... IC.5 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .......... .......... .......... .......... .......... .......... .........T .....T.... .........S ...... IC.6 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .I........ .......... .......... .......... .......... .......... .........T .....T.... .........S ...... IC.7 .S........ .....R...N .....S...D .......... G......... .......... L......... .......... ...I...... .......... .......... .......... .......... .......... .......... .........T .....T.... .........S ...... IC.8 ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ IC.9 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... ..IT...... .......... .......... .......... .......... .......... .........T .......... .........S ...... IC.10 .S.......E .....R...N .....S...D .......... .......... .......... L....S.... .......... ...I...... ..A....A.. .......... .......... .......... .......... .......... .........T .......... .........S ...... IC.11 .S........ .....R.S.N .....S...D .......... .......... .......... L......... .......... ...I...... .......... .......... .......... .......... .......... .......... .........T .......... .........S ...... IC.12 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .......A.. .......... .......... .......... .......... .......... .........T .....T.... D........S ...... IC.13 .S........ .....R...N .....S...D .......... .......... .......... L......... .......... ...I...... .......... .......... .......... .......... .......... .......... .........T .....T.... .........S ...... Figure 3 reference to consensus subtypededuced amino acids of HIV-1 reverse transcriptase (RT) gene from mother-infant pair C in Multiple sequence alignment of B (CON B) RT sequence Multiple sequence alignment of deduced amino acids of HIV-1 reverse transcriptase (RT) gene from mother-infant pair C in reference to consensus subtype B (CON B) RT sequence. In the alignment, the top sequence is CON B RT sequence and the bottom sequences are mother-infant pair C sequences (M refers to mother sequences and I to sequences). The number of clones sequenced is represented with clone numbers. The structural elements of RT are indicated above the alignment. Dots represent amino acid agreement with CON-B and substitutions are shown by single letter codes for the changed amino acid. Stop codons are shown as x and dashes represent gaps or truncated protein. Spanning arrowheads indicated above the align- ment shows relevant amino acid motifs and domains essential for RT function. mates of genetic diversity shown as theta values Dynamics of HIV-1 RT gene evolution in mother-infant (estimated as nucleotide substitutions per site per genera- isolates The maximum likelihood estimates and chi square tests tion) are shown in Table 3. The levels of genetic diversity performed by Modeltest 3.06 [35] suggested different among infected mothers and infants, as estimated by Wat- models of evolution for each patient sample. The esti- terson method, ranged from 0.012 to 0.025 and 0.009 to mates of genetic diversity of RT sequences from the five 0.021, respectively. Similar results were obtained when mother-infant pairs were determined by using the Watter- the mother-infant pair populations were analyzed by the son model, assuming segregating sites and the Coalesce Coelesce method, with the values ranging from 0.020 to method assuming a constant population size. The esti- 0.058 in mothers and from 0.016 to 0.060 in infants. Page 6 of 17 (page number not for citation purposes)
  7. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Finger Palm Template grip (73-90) D110 CTL epitope Active site 1 50 110 150 187 CON B PISPIETVPV KLKPGMDGPK VKQWPLTEEK IKALVEICTE MEKEGKISKI GPENPYNTPV FAIKKKDSTK WRKLVDFREL NKRTQDFWEV QLGIPHPAGL KKKKSVTVLD VGDAYFSVPL DKDFRKYTAF TIPSINNETP GIRYQYNVLP QGWKGSPAIF QSSMTKILEP FRKQNPDIVI YQYMDDL MD.1 .......... .......... .....S.... .......... .......... .......... .......... .......... .........A .......... .......... .......... .E........ ....T..... .......... .......... .C........ .......... ....... MD.2 .........A .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .E.S...... ....T..... .......... .......... .C........ .......... ....... MD.3 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .E........ .T..T..... .......... .......... .C....T... .......... ....... MD.4 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .E........ .T..T..... .......... .......... .C....T... .......... ....... MD.5 .....G.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .E........ ....T..... .......... .......... .CR....... .......... ....... MD.6 .......... .......... .......... M......... .......... .......... .......... .......... .......... .......... .......... .......... .E........ ....T..... .......... .......... .C........ .......... ....... MD.7 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EG....... .......... .......... ........M. .C........ .......... ....... MD.8 .......... .......... .......... .......... .......... .......... .......... R......... .......... .......... .......... .......... .E........ ........P. .......... ........T. .C........ .......... ....... MD.9 .......... .......... .......... .......... .......... .......... ..M....... .......... .......... .......... ........... .......... .EG....... .......... .......... .......... C......... .......... ....... MD.10 .........A .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EG....... .......... .......... .......... HC........ .......... ....... MD.11 .........A .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EG....... .......... .......... .......... .C........ .......... ....... ID.1 .......... .......... .......... ....I..... L......... .......... .......... .......... .......... .......... .......... .......... .E........ ....T..... .......... .......... .C........ .......... ....... ID.2 .......... .......... .......... ....I..... .......... .......... .......... .......... .......... .......... .......... .......... .E........ ....T..... .......... .......... .C........ .......... ....... ID.3 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .E........ ....T..... .......... .......... .C........ .......... ....... ID.4 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .E........ ....T..... .......... .......... .C........ .......... ....... ID.5 .......... .......... ..R....... ....I..... .......... .......... .......... .......... .......... .......... .......... .......... .E........ S...T.H... R.....H... ...E...... .C..S..... .......... ....... ID.6 ....T..... .......... .......... ....I..... L......... .......... .......... .......... .......... .......... ..E....... .......... .E........ ....T..... .......... .......... .C...R.... .......... ....... ID.7 .......... .......... .......... ....I..... .......... .......... .......... .......... .......... .......... .......... .......... .E........ ....T..... ........F. .......... .C.....I.. .......... ....... ID.8 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .EG....... ....T..... .......... .......... .C........ .......... ....... ID.9 .......... .......... .......... ....I..... .......... .......... .......... .......... .......... .......... .......... .......... .E........ ....T..... .......... .......... .C........ .......... ....... ID.10 .......... .......... .......... ....I..... .......... .......... ......N..R .......... .......... .......... .......A.. .......... .E........ ....T..... .......... .......... .C........ .......... ....... Thumb Connection Template and primer binding helices αH αI Primer grip(227-235) 188 250 300 374 CON B YVGSDLEIGQ HRTKIEELRQ HLLRWGFTTP DKKHQKEPPF LWMGYELHPD KWTVQPIVLP EKDSWTVNDI QKLVGKLNWA SQIYAGIKVK QLCKLLRGTK ALTEVIPLTE EAELELAENR EILKEPVHGV YYDPSKDLIA EIQKQGQGQW TYQIYQEPFK NLKTGKYARM RGAHTNDVKQ LTEAVQK MD.1 .......... .......... .......... .......... .......... .......... .R........ .......... .......... ........A. .....V.... .......... .......... ........V. .......... .......... .......... .......... ....... MD.2 .......... .......... .......... .......... .......... .......... .......... .......... .......... ........A. .....V.... .......... .......... ........V. .......... .......... .......... .......... ....... MD.3 .......... .......... .......... .......... .........G .......... .........T ....E..... .......... ........A. ..A..V.... .......... .......... .....R..V. .......... .......... ......H... .......... ....... MD.4 .......... .......... .......... .......... .........G .......... .........T ....E..... .......... ........A. .......... .......... .......... C.......V. .......... .......... D......... .......... ....... MD.5 ..R....... .......... .......... .......... .......... .......... ..N..I.H.. .......... .........X ........A. ..A....... .......... .......... ........V. .......... .......... .......... .......... ....... MD.6 .......... .......... .......... .......... .......... .......... .......... .......... .......... ........A. .......... .......... .......Q.. ........V. .......... .......... .......... .......... ....... MD.7 .......... .......... .......... .......... .......... .......... .......... .......... .......... ........A. .......... .......... .V........ ........V. .......... .......... .......... .......... ....... MD.8 .......... .......... ......L... .........S .......... ....R..... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... MD.9 .......... .......... .......... .......... .......... .......... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... MD.10 .......... .......... .......... .......... .......... .......... .......H.. .......... .......... ........A. V......... .......... .......... ........V. .......... .......... .......... .......... ....... MD.11 .......... .......... .......... .......... .......... .......... .......... ....E..... .......... ........A. .......... .......... .V.......A ........V. .T........ .......... .......... ...R...... ....... ID.1 .......... .......... .......F.. .Q........ .......... .......... .......... .....R.... .......... ........A. .P........ .......... .......... ........V. .......... .......... .......... .......... ....... ID.2 .......... .......... .......F.. .Q........ .......... .......... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... ID.3 .......... .......... .......F.. .Q........ .......... .......... .......... .....R.... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... ID.4 .......... ........K. .......F.. .Q........ .....G.... .......... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... ID.5 .......... .......... ..V....F.. ...LP..... P......... ..A.P.L... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... ID.6 .......... Y......... ..W....F.. .......... .......... .......... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... ID.7 ...P...... .......... .......A.. .......... .......... ......V... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... ID.8 .......... .......... .......A.. .......... .......... ......V... .......... .......... .......... ........A. .......... .......... .......... ..X.....V. .......... .......... .......... .......... ....... ID.9 .......... .......... .......... .......... .......... ......V... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... ID.10 .......... .......... .......F.. .Q........ .......... .......... .......... .......... .......... ........A. .......... .......... .......... ........V. .......... .......... .......... .......... ....... Connection RNase H RNase H Active sites D443 E478 D498 D549 ↓ ↓ ↓ ↓ 375 455 505 560 CON B IATESIVIWG KTPKFKLPIQ KETWEAWWTE YWQATWIPEW EFVNTPPLVK LWYQLEKEPI VGAETFYVDG AANRETKLGK AGYVTDRGRQ KVVPLTDTTN QKTELQAIHL ALQDSGLEVN IVTDSQYALG IIQAQPDKSE SELVSQIIEQ LIKKEKVYLA WVPAHKGIGG NEQVDKLVSA GIRKVL MD.1 .S........ .....R.... ........M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.2 .S........ .....R.... ........M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.3 .S........ .....R.... ........M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.4 .SP....... .....R...P ........M. .......... ...H....W. .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.5 .S........ .....X.... ........M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.6 .S........ .....R.... ........M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.7 .S........ .....R.... ........M. .......... .......... .......... .......... .......... .......... ..IP...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.8 .S........ .....R.... ........M. .......... .......... .......... .E........ .......... ...I...... ...P...... ........N. T......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.9 .S........ R....R.... ........M. .......... .......... .......... .......... .........R ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.10 .S........ .....R.... ........M. .......... ...S...... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. MD.11 .S........ .....R.... ........M. ......T... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T........ ....I. ID.1 .S........ .....R.... ........M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......Q.. ..V....... .......... .......... .T.......T ...... ID.2 .S........ .....R.... .....T..M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......Q.. ..V....... .......... .......... .T.......T ...... ID.3 .S........ .....R.... .....T..M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... ...G...... .......Q.. ..V....... .......... .......... .T.......T ...... ID.4 .S........ .....R.... .....T..M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .........I .......... .......Q.. ..V....... .L........ .......... .T.......T ...... ID.5 .S........ .....R.... .....T..M. .......... .......... .......... A......... .......... ...I...... ...P...... ........N. .......... .......... .......Q.. ..V...LL.. .L........ .......... .T.......T ...... ID.6 .S........ .....R.... .....T..M. .......... .......... .......... A......... .......... ...I.VL... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T.......T ...... ID.7 .S........ .....R.... .....T..M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......Q.. ..V....... .......... .......... .T.......T ...... ID.8 .S........ .....R.... .....T..M. .......... ...H...... .......... A......... .......... .......... ...P...... ........N. .......... .......... .......Q.. .GV....... .......H.. .......... .T.......T ...... ID.9 .S........ .....R.... ........M. .......... .......... .......... .......... .......... ...I...... ...P...... ........N. .......... .......... .......... ..V....... .......... .......... .T.......T ...... ID.10 .S........ .....R.... .....T..M. .......... .......... .......... A......... .......... .......... ...P...... ........N. .......... .......... .......Q.. ..V....... .......... .......... .T.......T ...... Multiple4 Figure sequence alignment of deduced amino acids of HIV-1 reverse transcriptase (RT) gene from mother-infant pair D Multiple sequence alignment of deduced amino acids of HIV-1 reverse transcriptase (RT) gene from mother-infant pair D. The patient sequences are aligned in reference to consensus RT sequence of HIV-1 subtype or clade B (CON B) at the top. In the mother-infant pair sequences, each line refers to a clone identified by a clone number with M referring to mother and I to infants. The structural elements of RT are indicated above the alignment. Dots represent amino acid agreement with CON-B and substitutions are shown by single letter codes for the changed amino acid. Stop codons are shown as x and dashes repre- sent gaps or truncated protein. Relevant amino acid motifs and domains essential for RT activity are shown by spanning arrow- heads indicated above the alignment. These data suggest that the mother and infant populations are under the same selection pressure with the same evolved very slowly and at similar rates. The differences underlying dN/dS ratio [38]. As substitutions of critical observed in the estimates of genetic diversity between and regions of a protein can lead to deleterious mutations, it is mothers and infants sequences are not statistically unrealistic to make assumptions about equal degree of significant. selection throughout the protein. In cases where positive selection is operating on proteins, it has been shown that only a limited number of amino acids may be responsible Rates of accumulation of nonsynonymous and for adaptive evolution. In such a case, methods that esti- synonymous substitutions Selection pressure on the RT gene was estimated as a ratio mate dN/dS ratios over an entire sequence may fail to of accumulation of non-synonymous to non-synony- detect positive selection even when it exists [39]. The mous substitutions using the Nielsen and Yang model codeML method uses the codon as a unit of evolution as [36] as implemented in codeML [37]. Although there are opposed to a nucleotide, and thus allows us to estimate several models to predict the rate of positive selection, the percentage of positions that are being positively most of these models assume that all sites in a sequence selected instead of averaging the rates of positive selection Page 7 of 17 (page number not for citation purposes)
  8. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Finger Palm Template grip (73-90) D110 CTL epitope Active site 1 50 110 150 187 CON B PISPIETVPV KLKPGMDGPK VKQWPLTEEK IKALVEICTE MEKEGKISKI GPENPYNTPV FAIKKKDSTK WRKLVDFREL NKRTQDFWEV QLGIPHPAGL KKKKSVTVLD VGDAYFSVPL DKDFRKYTAF TIPSINNETP GIRYQYNVLP QGWKGSPAIF QSSMTKILEP FRKQNPDIVI YQYMDDL MF.1 .......... .......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... MF.2 .......... Q......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... MF.3 .........I .......... .......... ....L..... .......... .......... .......... .......... ..K....... .......... ........... .......... .P........ .......... .......... .......... .S.....I.. S.....E... ....... MF.4 .......... Q......... .......... .......... .......... .......... .......... .......... ..K....... .......... .R........ .......... .P........ .......... .......... .......... .N........ ......E... ....... MF.5 .......... .......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .........S ......E... ....... MF.6 .......... Q......... .......... .......... .......... .......... .......... .......... ..K....... .......... .R........ .......... .P........ .......... .......... .......... .N........ ......E... ....... MF.7 .......... .......... .......... ....L..... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... MF.8 .......... .......... .......... ....L..... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... MF.9 .......... .......... .......... .......... .......... .......... .......... ....A..... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... MF.10 .......... .......... .......... ....L..... .......... .......... .......... ........G. ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... MF.11 .......... Q......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... MF.13 .......... Q......... .......... .......... .......... .......... .......... .......... ..K...S... .......... .......... .......... .P........ .......... .......... .......... .N........ ......E... ....... MF.14 .......... .......... .......... ....L..... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......G... ....... IF.1 .......... .......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... IF.2 .......... .......... .R.R...... .......... .......... .......... .......... .......... ..K....... .......... .......... .R........ .P........ .......... .......... .......... .......S.. ......E... ....... IF.3 .......... .......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... L.....E... ....... IF.4 .......... .......... .......... .......... .......... .......... .......... .......... ..K....... .......... .......... .......... .P........ .......... .......... .......... .......... ......E... ....... IF.5 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .P........ .......... .......... .......... .......... ......E... ....... IF.6 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .P........ .......... .......... .......... .......... ......E... ....... IF.7 .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... GP........ .......... .......... .......... .......... ......E... ....... IF.8 .......... ......N... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .P........ .......... .......... .......... .......... ......E... ....... IF.9 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .P........ .......... ....X..... .......... ........K. ......E... ....... IF.10 .....D.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......A.. .P........ .......... .......... .......... .......... ......E... ....... IF.11 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K.......N .......... .P........ ........A. .......... R......... ........G. ......E... ....... IF.12 .....D.... .....I.... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .P........ ...X...... .......... .......... .......... ......E... ....... Thumb Connection Template and primer binding helices αH αI Primer grip(227-235) 188 250 300 374 CON B YVGSDLEIGQ HRTKIEELRQ HLLRWGFTTP DKKHQKEPPF LWMGYELHPD KWTVQPIVLP EKDSWTVNDI QKLVGKLNWA SQIYAGIKVK QLCKLLRGTK ALTEVIPLTE EAELELAENR EILKEPVHGV YYDPSKDLIA EIQKQGQGQW TYQIYQEPFK NLKTGKYARM RGAHTNDVKQ LTEAVQK MF.1 .......... .......... .......... .......... .......... .......... ......GH.. .......... G........R E..N...... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.2 .......... .......... .P........ .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.3 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... .A..... MF.4 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.5 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.6 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.7 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.8 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.9 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.10 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.11 .......... .......... ......L... .......... .......... ..A....... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... MF.13 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... ..G....... .......... .......... .......... .......... ....... MF.14 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IF.1 .......... .......... .......... .......... ..V....... Q......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IF.2 .......... .......... .......... .......... .......... .......... .......... .......... .........R E..T...... .......... .......... .....L.... .......... .......... .......... .......... .......... ....... IF.3 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......S.. .......... .......... .......... ....... IF.4 .......... .......... .......... .......... .......... .......... .......... ......M... ...SQ....R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IF.5 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... ..G....... .......... .......... .......... .......... .......... .......... ....... IF.6 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IF.7 .......... .......... .......... .......... .......... .......... .......... .......... .......... E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IF.8 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IF.9 .......... .......... .......... .......... .......... .......... .......... .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IF.10 .......... .......... .......... .......... ......P... .......... .......... .......... .........R E.......A. .......... .......... .......... .......... .......... .......... .......T.. .......... ....... IF.11 .......... .......... .......... .......... .......... .......... .......... ......MD.. .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... IF.12 .......... .......... .......... .......... .......... .......... .........L .......... .........R E......... .......... .......... .......... .......... .......... .......... .......... .......... ....... Connection RNase H RNase H active sites D443 E478 D498 D549 ↓ ↓ ↓ ↓ 375 455 505 560 CON B IATESIVIWG KTPKFKLPIQ KETWEAWWTE YWQATWIPEW EFVNTPPLVK LWYQLEKEPI VGAETFYVDG AANRETKLGK AGYVTDRGRQ KVVPLTDTTN QKTELQAIHL ALQDSGLEVN IVTDSQYALG IIQAQPDKSE SELVSQIIEQ LIKKEKVYLA WVPAHKGIGG NEQVDKLVSA GIRKVL MF.1 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... ....D..... .......... .........T ...... MF.2 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... ..N....... .......... .......... ...... MF.3 ..M....... .....R.... .....T.... .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... ..N....... .......... .......... ...... MF.4 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... .......... .......... .......... ......S... .......... .......... ....N..... .......... .......... .......... ...... MF.5 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....NP.... ..NQ...... .......... .........T ...... MF.6 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... .......... .......... .......... ......S... .......... .......... ....N..... .......... .......... .......... ...... MF.7 ..V....... .....R.... .....T.... .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... .......... .......... .........T ...... MF.8 ..M....... .....R.... .....T.... .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... .......... .......... .........T ...... MF.9 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... ..N....... .......... ....G....T ...... MF.10 ..M....... .....R.... .....T.... .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... .......... .......... .........T ...... MF.11 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... ..N....... .......... .........T ...... MF.13 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... ..N....... .......... .........T ...... MF.14 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... .......... .......... .......... ......S... .A........ .......... ....N..... .......... .......... .........T ...... IF.1 ..M....... .....R.... .....T.... .......... .......... .......... .......... ....G..... ......K... .......... .......... ......S... .......... .......... ....N..... .......... .......... .......... ...... IF.2 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N...G. .......... .......... .......... ...... IF.3 ..M....... .....R.... ..A..T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... .......... ....N..... .......... .......... .......... ...... IF.4 ..M....... .....R.... .....T..A. .......... .......... ........L. .......... .......... ......K... .A........ .......... ......S... .......... .......... ....N..... .......... .......... .........T ...... IF.5 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .A........ .......... ......S... .......... .......... ..I.N..... .......... .......... .......... ...... IF.6 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ..L...S... .......... .......... ....N..... .......... .......... .......... ...... IF.7 ..M..V.... .....R.... .....T.... .......... .......... .......... .......... .......... ......K... .A........ .......... ......S... .......... .......... ....N..... ..T....... .......... .......... ...... IF.8 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .......... .......... ......S... .......... ...V...... ....N..... .......... .......... .......... ...... IF.9 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .A........ .......... ......S... .......... ...V...... ....N..... .......... .......... .......... ...... IF.10 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .A........ .......... .S....S... ....P..... .......... ....N..... .......... .......... .......... ...R.. IF.11 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ..C...K... .......... .......... ......S... .......... .........G ....N..... .......... .......... .......... ...... IF.12 ..M....... .....R.... .....T..A. .......... .......... .......... .......... .......... ......K... .A.....A.. .......... ......S... .......... .......... ....N..... .......... .......... .......... ...... Figure sequence alignment of deduced amino acids of HIV-1 reverse transcriptase gene from mother-infant pair F Multiple5 Multiple sequence alignment of deduced amino acids of HIV-1 reverse transcriptase gene from mother-infant pair F. In the alignment, the top sequence (CON B) is the consensus subtype B RT sequence and the bottom sequences are from mother- infant pair F sequences (M stands for mother sequences and I for infant sequences and the number of clones for mother and infant are indicated by clone number). The structural elements of RT are indicated above the alignment. Dots represent amino acid agreement with CON-B and substitutions are shown by single letter codes for the changed amino acid. Stop codons are shown as x and dashes represent gaps or truncated protein. Relevant amino acid motifs and domains essential for RT functions are shown by spanning arrowheads indicated above the alignment. over the entire gene [39]. This method also provides the tion. In case of infants C and F, there was no positive selec- percentage of mutations that are conserved, neutral or tion on the mutations and most of the substitutions were positively selected based on dN/dS values of 0, 1 or > 1, neutral. All mothers generally displayed a higher propor- respectively. The dN/dS values as well as the proportions tion of positively selected p3 sites as compared to the of each site category estimated using the Nielsen and Yang infants. Although the dN/dS values for infant H1 and H2 model are shown in Table 4. As described in the methods, seem higher than mother H, closer observation shows that a dN/dS value of greater than 1 suggests positive selection. the percentage of sites undergoing positive selection is The percentage of the substitutions being positively higher in the mother than in the twin infants. Table 4 selected is shown in column p3. Except for viral popula- shows that in mothers, over half the sites (66.6%) belong tions in infants C and F, all isolated populations were to the conserved p1 category, whereas the frequency of associated with dN/dS ratio >1, indicating positive selec- neutral and positively selected sites was equally distrib- Page 8 of 17 (page number not for citation purposes)
  9. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Finger Palm Template grip (73-90) D110 CTL epitope Active site 1 50 110 150 187 CON B PISPIETVPV KLKPGMDGPK VKQWPLTEEK IKALVEICTE MEKEGKISKI GPENPYNTPV FAIKKKDSTK WRKLVDFREL NKRTQDFWEV QLGIPHPAGL KKKKSVTVLD VGDAYFSVPL DKDFRKYTAF TIPSINNETP GIRYQYNVLP QGWKGSPAIF QSSMTKILEP FRKQNPDIVI YQYMDDL MH.1 .....D.... .......... ..R....... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... ..K....... .......... .......... ...R...... ....... MH.2 .....A.... .......... ..R....... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......T.. .......... ...R...... ....... MH.3 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... MH.4 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .V........ .......... .......... .......... ....... MH.5 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... ...L...... .......... ..K....... .......... .......... ...R...... ....... MH.6 .......... .......... .......... .......... .......... .......... .......... .......... ......I... .......... .K........ .......... .......... .......... ...H...... .......... .......... .......... ....... MH.7 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... ....S..... .......... ....... MH.8 .....D.... .......... .......... ..T....... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... ..K....... .......... .......... ...R...... ....... MH.9 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... ..K....... .......... .......... ...R...... ....... MH.10 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... MH.11 ......A... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... ..K....... .......T.. .......... ...R...... ....... MH.12 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... ..K....... .......... .......... ...R...... ....... MH.13 .......... .......... .......... .......... .......... .......... .......... .......... .......... ........E. .K........ .......... .......... .......... ..K....... .......T.. .......... L..R...... ....... MH.14 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... ..K....... .......... .......... ...R...... ....... Thumb Connection Template and primer binding helices αH αI Primer grip(227-235) 188 250 300 374 CON B YVGSDLEIGQ HRTKIEELRQ HLLRWGFTTP DKKHQKEPPF LWMGYELHPD KWTVQPIVLP EKDSWTVNDI QKLVGKLNWA SQIYAGIKVK QLCKLLRGTK ALTEVIPLTE EAELELAENR EILKEPVHGV YYDPSKDLIA EIQKQGQGQW TYQIYQEPFK NLKTGKYARM RGAHTNDVKQ LTEAVQK MH.1 ..R....... .........P ...K...... .....R.... ..I....... .......... .......... .......... G........R .......R.. ....I..... .......... .......... .......... .........X ....N..... .......... .......I.. ....... MH.2 ..R....... .......... ...K...... .......... ..I....... .......... .......... .......... ........AR .......R.. ....I..... .......... .......... .......... .........X .......... .......... .......I.. ....... MH.3 .......... .......... ...K...... .....E.... .......... ....P..... .......... .......... .........R .......... ....I..... .......... .......... ......E... .......... .......... .......... .......I.. ....... MH.4 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... ....G..... ......E... .......... .......... .......... .......I.. ....... MH.5 ..R....... .......... ...K...... .......... ..I....R.. .........L .......... ......XI.. .........R .......... ....I..... .......... ....G..... ......E... .......... .......... .......... .......I.. ....... MH.6 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... ......E... .......... .......... .......... .......I.. S...... MH.7 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... ......E... .......... .......... .......... ..V....I.. ....... MH.8 ..R....... .......... ...K...... .......... ..I....... .......... .......... .......... .........R .......R.. ....I..... .......... .......... .......... .........X .......... .......... .......I.. ....... MH.9 ..R....... .......... ...K...... .......... ..I....... .......... .......... .......... .........R .......R.. ....I..... .......... .......... .......... .........X .......... .R........ ...Y...I.. ....... MH.10 .......... .......... ...K...... .......... .......... .......... .......... P......... .........R .......... ....I..... .......... .......... ......E... .......... .......... .......... .......I.. ....... MH.11 ..R....... .......... ...K...... .......... ..I....... .......... .......... .......... ........AR .......R.. ....I..... .......... .......... ......E... .......... .......... .......... .......I.. ..G.... MH.12 ..R....... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... ......E... .......... .......... .......... .......I.. ....... MH.13 ..R....... .......... ...K...... ...L...... ..I......G .......... ...R..ATGL P......... .........R .......R.. ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... MH.14 ..R....... .......... ...K...... .......... ..I....... .......... .......... .......... .........R .......R.. ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... Connection RNase H RNase H Active sites D443 E478 D498 D549 ↓ ↓ ↓ ↓ 375 455 505 560 CON B IATESIVIWG KTPKFKLPIQ KETWEAWWTE YWQATWIPEW EFVNTPPLVK LWYQLEKEPI VGAETFYVDG AANRETKLGK AGYVTDRGRQ KVVPLTDTTN QKTELQAIHL ALQDSGLEVN IVTDSQYALG IIQAQPDKSE SELVSQIIEQ LIKKEKVYLA WVPAHKGIGG NEQVDKLVSA GIRKVL MH.1 .T......X. .....G.... ...X.T.... .........X .......... .......... A........R .......IR. .....N.... .......... .......... .......... .......... .......... ..V......E .......... ......R..R .........T R..... MH.2 .T......X. .....R.... ...X.T.... .........X .......... .......... A........R .......IR. .....N.... .......... .......... .......... .......... .......... ..V......E .......... ......R..R S........T R..... MH.3 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... .......... .........T ...... MH.4 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .R........ .......... .......... .......... ..V......E .L........ .......... ........RT ...... MH.5 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... ......R..R .........T R..... MH.6 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... ...G...... .......... ..V..P...E .L........ .......... ........RT ...... MH.7 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... .......... ........RT ...... MH.8 .T......X. .....R.... ...X.T.... .........X .......... .......... A........R .....A.I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... ..S...R..R .........T R..... MH.9 .T......X. .....R.... ...X.T.... .........X .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... ..S...R..R .........T R..... MH.10 .T........ .....R.... .....T.... .......... .......S.. .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V..P...E ....G..... ....P.R... .........T R..... MH.11 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... ......G... R......... .......... .......... .......... ..V......E .......... ....P.R... .........T R..... MH.12 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... ..P....... ..V...LL.E .X.RK..... ....P.R... .........T R..... MH.13 .T........ .....R.... .....T..A. .......... .......... .......... A........R .......IR. .....N.... .......... .......... .......... .......... .......... ..V......E .......... ......R..R .........T R..... MH.14 .T........ .....R.... .....T.... .......... .......... .......... A........R .......IR. .....N.... .G........ .......... .......... .......... .......... ..V......E ...M...... ......R..R .........T R..... Figure sequence alignment of deduced amino acids in Figure 7) birth to infected twins, H1 and H2 (alignment shown of HIV-1 reverse transcriptase (RT) gene from mother H, who had given Multiple6 Multiple sequence alignment of deduced amino acids of HIV-1 reverse transcriptase (RT) gene from mother H, who had given birth to infected twins, H1 and H2 (alignment shown in Figure 7). In the mother H sequences, each line refers to a clone iden- tified by a clone number with M referring to mother. The mother sequences are aligned in reference to consensus RT sequence of HIV-1 subtype or clade B (CON B) shown at the top. The structural elements of RT are indicated above the align- ment. Dots represent amino acid agreement with CON-B and substitutions are shown by single letter codes for the changed amino acid. Stop codons are shown as x and dashes represent gaps or truncated protein. Spanning arrowheads indicated above the alignment shows relevant amino acid motifs and domains required for RT activity. uted. This is in contrast to the viral population from the analysis showed that the RT gene in both the mothers and infants where the conserved site category (p1) had a fre- infants is under positive selection pressure. quency of only 36.5% and close to half the sites (55.7%) belongs to the neutral p2 category. Statistical analysis Analysis of functional domains of RT in mother-infant revealed that only the proportion of the neutral p2 cate- pairs gory was significantly different between mothers' and HIV-1 RT is a heterodimeric protein comprising of two infants' sequence viral populations (p < 0.05). This is sig- subunits, p66 and p51. The larger subunit of the het- nified by the case that all the sites in Infant F belonged to erodimer acts as an RNA-dependant DNA polymerase, a the p2 category. Higher proportion of p2 sites in infants DNA-dependant DNA polymerase and an RNase H that is have also been shown in the nef gene product in these associated with the C-terminus [15,16]. The p66 is folded same mother infant pairs [40]. The variable (positively to form a structure similar to the right hand with palm, selected) sites (p3) in the mothers' sequences were associ- finger and thumb subdomains [21,23,32] that are con- ated with dN/dS ratios that ranged from 2.34 to 8.9, with nected to the RNase H by the "connexion" subdomain viral sequence populations from three mothers (MD, MF, [22,24,25]. Each domain has several secondary structural MH) that displayed a dN/dS ratio of below three. This is elements, which are critical for primer binding, template in contrast to the infants' viral populations that were binding [14,22,23,26,27,41] and nucleotide recruitment either associated with a dN/dS of below 1, indicating no [28]. The active sites of the polymerase comprise of aspar- directional selection (IC and IF), a dN/dS ratio between 3 tic acid (D) residues at positions 110, 185 and 186, which and 4 (IB and ID) or a very high dN/dS ratio as found in are located in the palm subdomain at the bottom of the the sequences isolated from the twins H1 and H2. This DNA binding cleft [22,23]. Mutations of these aspartic Page 9 of 17 (page number not for citation purposes)
  10. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Finger Palm Template grip (73-90) D110 CTL epitope Active site 1 50 110 150 187 CON B PISPIETVPV KLKPGMDGPK VKQWPLTEEK IKALVEICTE MEKEGKISKI GPENPYNTPV FAIKKKDSTK WRKLVDFREL NKRTQDFWEV QLGIPHPAGL KKKKSVTVLD VGDAYFSVPL DKDFRKYTAF TIPSINNETP GIRYQYNVLP QGWKGSPAIF QSSMTKILEP FRKQNPDIVI YQYMDDL IH1.1 .....A.... .......... ..R....... ........A. .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH1.2 .....A.... .......... ..R....... ........A. .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH1.3 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .....E.... .......... ....... IH1.4 .....D.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH1.5 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH1.6 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH1.7 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .........L .......... .......... .......... .......... .......... ....... IH1.8 .......... .......... .......... .......... .......... .......... .......... ......S... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH1.9 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH1.10 .......... .......... .......... .......... .......... .......... .......... ........G. .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH1.11 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .....E.... .......... ....... IH2.1 .....A.... .......D.. .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH2.2 .....D.... .......... ..R....... .......... .......... .......... .......R.. .......... .......... .......... .K........ .......... .......... .......... .......... ........M. .......... .......... ....... IH2.3 .....D.... .......... .......... .......... .......... .........A .......... .......... .......... .......... .K........ .......... .......... .......G.. .......... ....E..... .......... .......... ....... IH2.4 .....A.... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .....L.... .......... .......... .......... .......... .......... .......... ....... IH2.5 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH2.6 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .....Q.... ....... IH2.7 .......... .......D.. .......... .......... .K........ .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH2.8 .......... .......... .......... .......... .......... .......... ..M....... .......... .......... .......... .K........ .......... .......... ....T..... .......... .......... .......... .K........ ....... IH2.9 .......... ..R....... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... .......... .......... .......... .......... .......... .......... ....... IH2.10 .......... .......... .......... .......... .......... .......... .......... .......... .......... .......... .K........ .......... G......... .......... .......... .......... .......... .......... ....... IH2.11 .......... ......GD.. .......... .......... .......... .......... .......... .........P .......... .......... .K........ ......L... .......... .......... .......... .......... .......... ..E....... ....... Thumb Connection Template and primer binding helices αH αI Primer grip(227-235) 188 250 300 374 CON B YVGSDLEIGQ HRTKIEELRQ HLLRWGFTTP DKKHQKEPPF LWMGYELHPD KWTVQPIVLP EKDSWTVNDI QKLVGKLNWA SQIYAGIKVK QLCKLLRGTK ALTEVIPLTE EAELELAENR EILKEPVHGV YYDPSKDLIA EIQKQGQGQW TYQIYQEPFK NLKTGKYARM RGAHTNDVKQ LTEAVQK IH1.1 .......V.. .......... ...K...... .......... .......... .......... .......... .......... ....S....R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH1.2 .......V.. .......... ...K...... .......... .......... .......... .......... .......... ....S....R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH1.3 .......... .......... ...K...... .......... .......... .......... .......H.. .E........ ....P....R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH1.4 .......... .....G.... ...K...... .......... .......... .......... .......... .......... ....S....R .......... ....I..... .......... .......... .......... .........X .......... .......... .......I.. .A..... IH1.5 .......... .........P ...K...... .......... .......... .......... .......M.L P......D.. ....S....R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH1.6 .......... ....M..... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... .......... ..R....... .......... .......... .......I.R ....... IH1.7 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... ......G... .......... .......... .......... .......... .......I.. ....... IH1.8 .......... .......... ...K...... ......G... .......... .......... .......... .......... ....S....R .......... ....I..... .......... .......... C......... .......... .......... .......... .......I.. ....... IH1.9 .......... .......... ...K...... .......... .......... .......... .......M.. .......... ....S....R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH1.10 .......... .......... ...K...... .E........ .......... .......... .......... .......... ....S....R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH1.11 .......... .......... ...K...... .......... .......... .......... .......H.. .E........ ....P....R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH2.1 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH2.2 .......... .......... ...K...... ...R...... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH2.3 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... .......... ...E...... .......... .......... .......I.. ....... IH2.4 .......T.. .......... ...K...... .......... .......... .......... .......... L......... .........R .......... ....I..... .......... .......... .......... ......R... .......... .......... .......I.. ....... IH2.5 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... .......... .......... .........N .......... .......I.. ....... IH2.6 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH2.7 .......... .......... ...K...... .......... .......... .......... .........V .......... .........R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH2.8 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... IH2.9 .......... .......... ...K...... .......... .......... .......... .......... .......... .........R .......... ....I..... .......... .N........ .......... ....R..... .......... .......... .......I.. ....... IH2.10 .......... .......... ...K...... .......... .......... .......... .......... .......... ......T... .......... ....I..... .......... .......... .......... .......... .......... .......... .......... ....... IH2.11 .......... .......... ...K...... .......... .......... .......... .........L .....R.... .........R .......... ....I..... .......... .......... .......... .......... .......... .......... .......I.. ....... Connection RNase H RNase H Active sites D443 E478 D498 D549 ↓ ↓ ↓ ↓ 375 455 505 560 CON B IATESIVIWG KTPKFKLPIQ KETWEAWWTE YWQATWIPEW EFVNTPPLVK LWYQLEKEPI VGAETFYVDG AANRETKLGK AGYVTDRGRQ KVVPLTDTTN QKTELQAIHL ALQDSGLEVN IVTDSQYALG IIQAQPDKSE SELVSQIIEQ LIKKEKVYLA WVPAHKGIGG NEQVDKLVSA GIRKVL IH1.1 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH1.2 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH1.3 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH1.4 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .......... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH1.5 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... ...P...... ..A....... .......... .......... .......... ..V......E .......... .......... ..R......T ...... IH1.6 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... ..R......T ...... IH1.7 .T........ .....R.... .....T.... .......... .......... .......... A.....H... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... ..R......T ...... IH1.8 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... ..R......T ...... IH1.9 .T........ .....R.... .......... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH1.10 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... ......G... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH1.11 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH2.1 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH2.2 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... .......... .........T ...... IH2.3 .T........ .....R.... .....T.... .......... .......... .......... A......... .....A.I.. .....N.... .......... ..A....... .......... .......... .......... ..V....M.E .......... .......... .........T ...... IH2.4 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... .......... .........T ...... IH2.5 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... .......... .........T ...... IH2.6 .T........ .....R.... .....T.... .......... G......... .......... A......... .......I.. .....S.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH2.7 .T........ .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .....R.... .......... ..V......E .......... .......... ..R......T ...... IH2.8 .T........ .....R.... .....T.... .......... .......... .......... T......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... .......... .........T ...... IH2.9 .T...V.... .....R.... .....T.... .......... .......... .......... A......... .......I.. .....N.... .......... .......... .......... .......... .......... ..V......E .......... .........R .........T ...... IH2.10 .T........ .....R.... R....T.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... IH2.11 .T........ .....R.... ....VT.... .......... .......... .......... A......... .......I.. .....N.... .......... ..A....... .......... .......... .......... ..V......E .......... .......... .........T ...... Figure 7 and H2 of mother alignment of deducedin Figure 6) of HIV-1 reverse transcriptase gene (RT) from infected twin infants, H1 Multiple sequence H (alignment shown amino acids Multiple sequence alignment of deduced amino acids of HIV-1 reverse transcriptase gene (RT) from infected twin infants, H1 and H2 of mother H (alignment shown in Figure 6). In the alignment, the top sequence is the consensus subtype B RT sequence (CON B) and the bottom sequences are of infants H1 and H2 represented by I and clone numbers. Dots represent amino acid agreement with CON-B and substitutions are shown by single letter codes for the changed amino acid. Stop codons are shown as x and dashes represent gaps or truncated protein. Relevant amino acid motifs and domains essential for RT activity are shown by spanning arrowheads indicated above the alignment. acid residues abrogates the polymerase activity of RT mother-infant RT sequences. The K263, K353 and R358 [22,23,29,32]. These aspartate residues of the RT active that form salt bridges with the phosphate groups site were conserved within the five mother-infant pairs RT [14,21,22,30,44] of the template and primer were found sequences. Furthermore, the D185 and D186 that form a to be conserved in most of the RT sequences analyzed. The part of an essential highly conserved YMDD [32,42,43] thumb subdomain of RT is comprised of two anti-parallel α helices, αH and αI, which bind to the opposite strand of motif involved in binding to the 3'OH of the primer dsDNA. The αH also directly inserts into the minor groove strand [14,26], were highly conserved in our mother- infant pairs' RT sequences (Figures 2 to 7). The amino of the DNA [14,22,41]. Both these helices were generally acids at positions 73–90 that constitute the template grip conserved in our mother-infant RT sequences. required for positioning and binding the RT template near the active site of the RT [23], were also conserved in most The connexion subdomain that links the RT to the RNase of our RT sequences. The primer grip responsible for H and forms the floor of the template binding cleft primer binding extends from amino acids 227 to 235 [22,24,25,42], showed some substitutions, including [22,23] and these amino acids were also conserved in the V293I, A376S and A400T in our mother-infant RT Page 10 of 17 (page number not for citation purposes)
  11. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Table 2: Distances in the RT sequences within mother sets, within infant sets, and betweenmother-infant pairs Nucleotide distances Within mothers Within infants Between mother and infants Pair Min Med Max Pair Min Med Max Pair Min Med Max MB 0.0 0.80 2.10 IB 0.0 0.80 1.30 B 0.0 1.05 2.05 MC 0.0 1.76 3.46 IC 0.0 1.49 2.17 C 0.0 1.70 3.26 MD 0.0 1.37 2.21 ID 0.0 1.37 2.21 D 0.0 1.74 4.48 MF 0.0 1.21 1.54 IF 0.0 1.31 2.93 F 0.0 1.22 2.08 MH 0.0 2.90 2.60 IH1 0.0 0.64 1.34 H 0.0 1.45 3.30 IH2 0.0 1.24 1.75 Total 0.0 1.34 3.46 Total 0.0 1.48 2.21 Total 0.0 1.32 4.48 Amino acid distances Within mothers Within infants Between mother and infants Pair Min Med Max Pair Min Med Max Pair Min Med Max MB 0.0 1.26 4.61 IB 0.0 1.44 2.72 B 0.0 1.44 4.57 MC 0.0 2.81 5.51 IC 0.0 2.35 4.01 C 0.0 2.90 5.51 MD 0.0 1.98 3.83 ID 0.0 1.80 4.57 D 0.0 2.53 6.47 MF 0.0 1.26 2.35 IF 0.0 1.62 3.09 F 0.0 1.44 3.09 MH 0.0 2.27 3.09 IH1 0.0 1.44 2.17 H 0.0 2.17 6.27 IH2 0.0 1.62 2.72 Total 0.0 1.52 5.51 Total 0.0 1.42 4.57 Total 0.0 2.90 6.47 M: mother; I: infant. Min: Minimum; Med: Median; Max: Maximum. Totals were calculated for all pairs together Table 3: Estimates of genetic diversity of HIV-1 RT within mother sets and infant sets MOTHERS INFANTS θw θc θw θc N Mother B 12 0.015 0.038 Infant B 12 0.014 0.033 Mother C 12 0.025 0.058 Infant C 13 0.021 0.060 Mother D 11 0.017 0.042 Infant D 10 0.019 0.040 Mother F 14 0.012 0.029 Infant F 12 0.018 0.053 Mother H 14 0.020 0.020 Infant H1 11 0.009 0.016 Infant H2 11 0.015 0.044 Totals 63 0.018 0.037 69 0.016 0.041 N – number of RT clones sequenced. θw – genetic diversity as calculated by the Watterson method; θc – genetic diversity as calculated by the Coelesce method. Totals were indicated as an average of all values. sequences. Mutations at positions H361 and Y501 positions were intact in all RT sequences (Figures 2 to 7). reduces RNase H activity [24]. Examination of the five Furthermore, the RNase H active sites contain four acidic mother-infant pairs' sequences revealed that these two amino acid residues, D443, E478, D498 and D549 Page 11 of 17 (page number not for citation purposes)
  12. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Table 4: dN/dS values in HIV-1 RT sequences within mother sets and within infant sets. MOTHER INFANT N P1 P2 P3 dN/dS N P1 P2 P3 dN/dS Mother B 12 53 18.8 27 8.9 Infant B 12 41 42 16 3.31 Mother C 12 55.5 43 1.3 6.09 Infant C 13 0 81.2 18.8 0.01 Mother D 11 70.6 5.7 23.6 2.52 Infant D 10 74.8 19.2 5.9 4.44 Mother F 14 81.7 7.8 10.4 2.67 Infant F 12 0 100 0 0.001 Mother H 14 72 0 27 2.34 Infant H1 11 47 50 2.8 14.04 Infant H2 11 56 42 0.6 16.58 Totals 66.5 15.1 18.4 4.50 69 36.5 55.7 7.8 6.39 N – number of RT clones sequenced.; P1 = proportion of conserved codons as a percent; P2 = proportion of neutral codons as a percent; P3 = proportion of positively selected codons as a percent. dN/dS = ratio of synonymous to non-synonymous at P3 sites. Totals were calculates as an average of all values. [22,24,25,41,42], which were highly conserved in our mutations were naturally occurring. It is interesting to mother-infant pairs sequences. In addition, several substi- note that the infant of this mother yielded several clones tutions were seen in regions of RT that are not known to with these two mutations. An R211K mutation known as have critical function. The relevance of these changes is an accessory mutation associated with NRTI resistance not known. [46] was also observed in all mother-infant pair H clones. Mutations associated with anti-retroviral drug resistance Immunologically relevant mutations in the CTL epitopes of Several naturally occurring mutations in the pol gene in RT treatment-naïve patients have been reported [45,46], The cytotoxic T lymphocyte (CTL) responses have been although most of these mutations are not seen in our RT shown to exert significant immune pressure during HIV-1 gene sequences. In addition, these mutations found in infection. Strong CTL responses are maintained in long- treatment-naïve patients were usually seen in non-sub- term nonprogressors and these responses correlate with type B infections and our patient population was from decrease in viral load [51-55]. It has been shown that subtype B infected individuals. These changes were transmitting mothers have larger numbers of CTL escape usually in amino acids where the mutations did not actu- variants as compared to non-transmitting mothers [56], ally confer nucleoside reverse transcriptase inhibitor emphasizing that CTL escape variants may become a part (NRTI) drug resistance but were accessory mutations [46- of circulating virus that influences vertical transmission 48]. Several amino acid changes in RT seen in patients [56,57]. Several regions in the RT gene have been shown undergoing NRTI therapy are selected primarily with zido- to elicit strong CTL responses during HIV-1 infection. The vudine (ZDV) treatment. These mutations referred to as CTL eptitope, TVLDVGDAY, between amino acid posi- thymidine analog mutations (TAMs) include M41L, tions 107–115 http://www.hiv.lanl.gov/content/immu D67N, K70R, L210N, T215Y/F and K219Q [47,49]. Since nology/ctl_search, is highly conserved among known most of our infected mothers were treatment naïve but HIV-1 isolates [57]. This epitope contains the amino acid infants were actively on ZDV therapy or on other drugs D110 which is part of the RT active site. This epitope was (Table 1), we examined the RT sequences for ZDV highly conserved in most of the mother-infant RT clones resistant mutations (Figure 2). Several TAMs associated sequenced (Fig. 2). with drug resistance were observed in our infants C and D who were either on prolonged or failed ZDV therapy. Another motif, TAFTIPSI, between amino acid positions These mutations included M41L in three clones from 128–135 is an HLA-B51 restricted epitope http:// infant C and two clones in infant D, D67N and K70R in www.hiv.lanl.gov/content/immunology/ctl_search. This five clones from infant C, L210W in one clone from infant epitope is present in the palm region consisting of posi- D and T215F in seven clones from infant D and K219Q in tions A129 and I135 as anchor residues [57]. This motif four clones from infant C and D. In addition, one clone was mostly conserved in the RT sequences of the five from infant C had all the above mutations, indicating sig- mother-infant pairs analyzed. In addition, I135T muta- nificant resistance to ZDV [46,50]. Although Mother C tion decreases CTL response but increasing concentration was not on any antiretroviral therapy two clones had of mutant peptide re-establishes appropriate responses TAMs at M41L and K219Q positions, suggesting that these Page 12 of 17 (page number not for citation purposes)
  13. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 [57]. The I135T mutation was seen in several of our were found to be a signature characteristic of each mother- mother-infant pair's D sequences. infant pair, even in older infants where infection has pro- gressed for more than 3 years. Phylogenetic analysis of the The next motif AIFQSSMTK from amino acid positions RT sequences revealed that the five mother-infant pairs 158–166, comprising of I159, F160, K166 anchor resi- were well discriminated, separated and confined within dues and recognized by several HLA types, is conserved subtrees (Fig. 1), indicating that the epidemiologically among known HIV-1 isolates and believed to be associ- linked mother-infant pairs were closer to each other and ated with vertical transmission [56,57]. Our mother- that there was no PCR product cross-contamination infant pairs' RT sequences showed conservation in this [66,67]. In addition, most of the mother and infant motif. Another CTL epitope YPGIKVRQL from positions sequences of the same pair formed separate subclusters, 271–279 has been reported to be conserved in transmit- with little intermingling between sequences of mother ting mothers and infants with several natural occurring and infant in some pairs. In some mother-infant pairs, variants [56], was also found to be conserved in our minor variants of the mothers seem to be predominating mother-infant pairs' RT sequences. In addition, a P272H in the infants, which was also seen in our previous V3 mutation that causes significant loss of CTL response for region analysis [68]. We also observed intermingling of this epitope [56] was not seen in any of the RT clones sequences in mother-H and her infected twins, indicating analyzed. that different mother's variants were transmitted to the twins. With respect to viral heterogeneity, there was a low degree of genetic variability in the RT sequences from Discussion In this study, we show for the first time that reverse tran- mother-infant pairs estimated by several methods. Similar scriptase open reading frames from five mother-infant levels of genetic diversity were seen in other conserved pairs following perinatal transmission were maintained genes of the same mother-infant pairs, including gag, vif, with a frequency of 87.2%. The functional domains vpr and tat [59-61,69]. The low degree of genetic variabil- required for reverse transcriptase activity in HIV-1 replica- ity was observed in RT sequences of mothers and main- tion were highly conserved in most of the mother-infants tained in the infants following transmission, suggesting sequences. We also demonstrate a low degree of sequence the essential nature of this gene in viral pathogenesis. It is variability and estimates of genetic diversity for reverse important to note that the mother-infant pairs retained transcriptase genes after mother-to-infant transmission. the same epidemiological relationship, even when some However, epidemiologically unlinked individual's of the infant's age was more than 2 to 3 years. We believe sequences were more heterogeneous than epidemiologi- this is an important finding that the epidemiological rela- cally linked mother-infant pair's sequences. Several motifs tionships as well as certain signature sequence motifs are in reverse transcriptase responsible for primer and tem- maintained in mother-infant pairs or transmitter-recipi- plate binding and positioning and motifs involved in ent partners no matter how long the infection has pro- nucleotide recruitment were conserved in all mother- gressed. This information may be critical in terms of infant pairs' sequences. The data we show here are compa- vaccine development. rable to those of our previously analyzed conserved genes, including gagP17MA, vif, vpr, tat and nef [58-62]. Our Examining the motifs of the deduced amino acid findings suggest that an intact and functional reverse sequences of the RT gene from five mother-infant pairs, transcriptase open reading frame is essential for HIV-1 we found that the essential motifs required for RT activity replication in mothers and their infants and low degree of were mostly conserved in our mother-infant pairs' viral heterogeneity is maintained following vertical sequences (Figure 2). The sites essential for primer bind- transmission. ing, template binding, positioning of template and primer, which are located in α-Helix H and α-Helix I The RT open reading frame was maintained in 115 of the [22,23], were are all conserved in RT sequences (Figure 2). 132 sequences (1680 base pairs sequenced), whereas 17 Specifically, the amino acids involved in recruitment of sequences contained stop codons (Figure 2). The fre- nucleotides during reverse transcription [28] were mostly quency of conservation in five mother-infant pairs was conserved. The active sites of the polymerase are located found to be 87.2%. The comparison of the RT sequences in the palm subdomain at the bottom of the DNA binding with those of other conserved genes from HIV-1 infected cleft comprising of aspartic acid (D) residues at positions mother-infant pairs showed comparable frequency of 110, 185 and 186 were conserved within the five mother- conversation, including gag p17 (86.2%), vif (89.8%), vpr infant pairs' RT sequences. Furthermore, the D185 and (92.1%), tat (90.9%), nef (86.2%) and vpu (90.12%). D186 also form a part of an essential YMDD motif, which There was no significant correlation between the conser- is highly conserved in known HIV-1 isolates vation of RT open reading frame and disease progression [14,22,23,26,32,43], was also conserved in our mother- in mothers and infants [63-65]. Several amino acid motifs infant pairs' RT sequences analyzed. Page 13 of 17 (page number not for citation purposes)
  14. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 Some of the amino acids of the connexion subdomain infants with the same properties [71]. Additional data on that are critical for RNase H activity and replication the properties of HIV-1 from mothers and infants follow- [9,24,25] are conserved in our RT sequences with several ing perinatal transmission presented in this study may aid substitutions of compatible nature, including V293I, in a better understanding of the molecular mechanisms of K358R, A376S, and A390T. These substitutions were vertical transmission and development of effective located in the regions of the connexion that forms the strategies for prevention and control of HIV-1 infection in base of the binding cleft. It is possible that such mutations children. in the binding cleft may change the size of the cleft and affect fidelity of the reverse transcriptase without affecting Conclusion the active site. Further assessment also shows that our RT We have demonstrated that an intact and functional RT sequences harbor mutations in the connexion and RNase gene was maintained in infected mother-infant pairs fol- H subdomains that are not at the critical sites required for lowing perinatal transmission. In addition, there was a RT activity. The implications of these mutations can be lower degree of viral heterogeneity and estimates of studied by performing the biological characterization of genetic diversity in epidemiologically linked mother- these RT clones in the context of HIV-1 replication. It infant pairs compared with epidemiologically unlinked would be interesting to determine whether the degree of individuals. Several amino acid motifs were found as a genetic variability and conservation of RT functional signature sequences in each mother-infant pair. We also domains in non-transmitting mothers and compare their found that the functional motifs of RT responsible for sequences with the data presented here. Nonetheless, the reverse transcription, DNA polymerization and RNase H data described here suggest that functional domains of the were highly conserved in mother-infant RT sequences. RT enzyme, including reverse transcriptase, DNA These findings support the notion that RT is essential for polymerase and RNase H, were highly conserved in our HIV-1 replication in mothers and their infected infants. five mother-infant pair sequences. Methods In terms of CTL epitopes in the RT gene, Wilson et al., PCR amplification, cloning and nucleotide sequencing have shown that the transmitting mothers have larger Peripheral blood mononuclear cells (PBMCs) were iso- numbers of CTL escape variants as compared to non- lated by a single step Ficoll-Hypaque procedure (Pharma- transmitting mothers but the transmitted viruses carrying cia-LKB) from whole blood samples of HIV-1-infected epitopes are not escape variants [56]. It is possible that the mother-infant pairs. DNA was isolated as described previ- CTL responses studied are tissue specific and a representa- ously [68]. The HIV-1 RT gene was amplified by a two-step tion of peripheral blood, and the virus and the CTL vari- PCR method, first using outer primers RT1 (5 GTACAG- ants in the placenta, birth canal, and breast milk are TATTAGTAGGACCTACACCTGTC, 2470 to 2498, sense) different [70]. In addition, there is evidence suggesting and RT2 (5'AAAATCACTAGCCATTGCTCTCCAATTAC, that Nef and Pol specific CTLs found in breast milk 4307 to 4279, antisense) and then with nested primers showed no detectable responses in peripheral blood. RT3 (5'TGGAAGAAATCTGTTGACTCAGATTGG, 2507 to Although several previously defined CTL motifs in the RT 2533, sense) and RT4, (5'TTCTCATGTTCTTGGGCCT- gene [56,57] were conserved in our RT sequences, other TATCT, 4270 to 4244, antisense). Equal amounts of mutations that either abrogated or improved the CTL PBMC DNA (approximately 25 to 50 copies from each responses [56,57] were not seen in our sequences. The patient) as determined by end-point dilution was sub- possibilities exist that the mutants observed in the CTL jected to multiple (5 to 8) independent PCRs to obtain epitopes in our study may contribute to differential clones that were sequenced and analyzed. PCRs were per- responses in a tissue specific manner and thus influence formed according the modified procedure of Ahmad et al., [68] in a 25 µl reaction mixture containing 2.5 µl of vertical transmission. 10X PCR buffer (100 mM Tris-HCL, pH 8.3, 100 mM KCl, 0.02% Tween 20), 2.5 mM MgCl2, 400 µM each of dATP, While antiretroviral treatment during pregnancy has dCTP, dGTP and dTTP, 0.2 to 1.0 µM of each of outer reduced the risk of vertical transmission in the United States, HIV-1 infection in children, as a result of perinatal primers, and 2.5 U of TaKaRa LA Taq polymerase (TaKaRa transmission, is still increasing rapidly in developing Biomedicals, Shiga, Japan). The reactions were carried out countries. There is a global need of better preventive at 94°C for 30s, 45°C for 45s and 72°C for 3 min for 35 strategies of HIV-1 vertical transmission. If we characterize cycles, with the last cycle allowing for seven minutes of the properties of the transmitted viruses, we can then additional polymerization. After the first round of PCR, 4µl of the first-PCR product was used for nested PCR, develop interventions against the properties of the trans- mitted viruses. We have already shown that the minor using inner primers and same reagents at 94°C for 30s, genotypes with R5 phenotypes are transmitted from 52°C for 45s and 72°C for 3 min for 35 cycles. We used mothers to infants and are initially maintained in the negative control with each PCR amplification and a Page 14 of 17 (page number not for citation purposes)
  15. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 known HIV-1 DNA, pNL4-3, to assess errors generated by synonymous (dS) substitutions by a maximum likelihood the LA Taq polymerase. To avoid contamination, all model using codeML, a part of the PAML [37] package. samples, reagents and PCR products were stored sepa- The Nielsen and Yang [36] model considers the codon rately and dispensed in a separate room free of all DNA instead of the nucleotide as the unit of evolution and used in the lab. The PCR products were then visualized on incorporates three distinct categories of sites. Every a 1% agarose gel, excised ad extracted by using a QIAquick mutation is three times more likely to cause a nonsynon- Gel Extraction kit (Qiagen Inc.). These DNAs were cloned ymous than a synononymous substitution and codeML into the TA cloning system (pCR 2.1-TOPO vector, Invit- accounts for this bias. The first category p1 represents the rogen Inc.) and transformed into chemically competent sites that are conserved and invariable where dN/dS = 0. TOP10 cells (Invitrogen Inc.). The white colonies were The second category p2 represents neutral sites where dN/ screened for correct size inserts and 10 to 14 clones from dS = 1 and represents sites at which the dN and the dS are each patient obtained from multiple independent PCRs fixed at the same rate. The third category p3 represents were initially manually sequenced and then sequenced sites that are under positive selection where the dN have a using University of Arizona Biotechnology Center auto- higher rate of fixation than dS proportionally and dN/dS mated system. >1. The dynamics of HIV-1 evolution was assessed using techniques of population genetics. In population genetics, genetic diversity is defined as θ = 2Neiµ, where Nei is the Sequence analysis inbreeding effective population size and µ is the per The nucleotide sequences of HIV-1 RT gene (approxi- mately 1680 bp) from five mother-infant pairs were ana- nucleotide mutation rate per generation. The Watterson lyzed with the Wisconsin package 10.1 version of the model based on segregating sites and the Kuhner model Genetics Computer group (GCG) and were translated to assuming constant population size were used to estimate corresponding deduced amino acid sequences (560 differences in genetic diversity, using the program Coa- amino acids). A multiple sequence alignment was lesce, http://inbio.byu.edu/faculty/kac/crandall_lab performed for the nucleotide and amino acid sequences which is part of the Lamarc software package. The tree files and the data matrixes from PAUP were used to estimate θ with a reference HIV-1 consensus clade or subtype B RT sequences with a gap-opening penalty of 10 and a gap values as a measure of genetic diversity. extension penalty of 5 using Clustal X. The transitions were not weighted and the amino acids were scored using Nucleotide sequence accession numbers a BLOSUM matrix. A model of evolution was optimized The sequences have been submitted to GenBank with for the entire nucleotide sequence data set using the accession numbers AY560388 to AY560528. approach outlined by Huelsenbeck and Crandall [33]. Likelihood scores for different models of evolution were Competing interests calculated using PAUP [34] and a chi square test was per- The author(s) declare that they have no competing formed by Modeltest 3.06 [34,35,40,72]. Using the Model interests. test and Akaike Information Criterion [72], all the null hypotheses were rejected except a GTR+G model. The five Authors' contributions rate categories were as follows: R (A-C) = 2.962, R (A-G) = VS carried out the PCR, cloning, and sequencing. VS and 10.5176, R (A-T) 1.3663, R (C-G) = 0.6563, R (C-T) TH performed the sequence analysis by computer pro- 12.5484, R (G-T) = 1. A gamma distribution with the grams. VS and NA participated in the experimental design, shape parameter (α) of the distribution estimated from data interpretation and writing of the manuscript. All the the data matrix via maximum likelihood was used to authors read and approved the final manuscript. account for the rate of heterogeneity. This shape parame- ter α was = 0.7775. The model of choice was incorporated Acknowledgements into PAUP [34] to estimate a neighbor-joining tree and This work was supported by grants to NA from the National Institute of Allergy and Infectious Disease (AI 40378, AI 40378-06) and the Arizona the tree was bootstrapped 1000 times to ensure fidelity. Disease Control Research Commission (ADCRC-7002, 8001). We thank Models to represent patterns of evolution of variants of Raymond C. Baker, Children's Hospital Medical Center, Cincinnati, Ohio each patient population were identified and were used to and Ziad M. Shehab Department of Pediatrics, University of Arizona Col- estimate corrected pairwise nucleotide distances using lege of Medicine for providing HIV-1-infected mother-infant pairs blood PAUP [34]. Amino acid distances were also estimated samples. We thank members of Ahmad Lab, including Tiffany Davis and using the Jukes-Cantor model with the Wisconsin package Kamlesh Patel for their help in cloning of the RT genes and Rajesh Ram- 10.1 of GCG. The minimum, median and maximum akrishnan, Roshni Mehta and Brian Wellensiek for critically reading this nucleotide and amino acid distances for each patient and manuscript and providing helpful suggestions. linked patient pairs were calculated from these data (Table 2). To analyze the evolutionary processes acting on the RT gene, we estimated the ratio of non-synonymous (dN) to Page 15 of 17 (page number not for citation purposes)
  16. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 References domains of human immunodeficiency virus type-1 (HIV-1) reverse transcriptase. J Mol Biol 1994, 243:472-483. 1. Lepage P, Van de Perre P, Carael M, Nsengumuremyi F, Nkurunziza J, 22. Jacobo-Molina A, Ding J, Nanni RG, Clark AD Jr, Lu X, Tantillo C, Butzler JP, Sprecher S: Postnatal transmission of HIV from Williams RL, Kamer G, Ferris AL, Clark P: Crystal structure of mother to child. Lancet 1987, 2:400. human immunodeficiency virus type 1 reverse transcriptase 2. Lowe DM, Parmar V, Kemp SD, Larder BA: Mutational analysis of complexed with double-stranded DNA at 3.0 A resolution two conserved sequence motifs in HIV-1 reverse shows bent DNA. Proc Natl Acad Sci U S A 1993, 90:6320-6324. transcriptase. FEBS Lett 1991, 282:231-234. 23. Kohlstaedt LA, Wang J, Friedman JM, Rice PA, Steitz TA: Crystal 3. Weinbreck PLV, Denis F, Vidal B, Muvnier M, DeLumley I: Postnatal structure at 3.5 A resolution of HIV-1 reverse transcriptase transmission of HIV infection. Lancet 1988, 1:482. complexed with an inhibitor. Science 1992, 256:1783-1790. 4. Ziegler JB, Cooper DA, Johnson RO, Gold J: Postnatal transmis- 24. Julias JG, McWilliams MJ, Sarafianos SG, Alvord WG, Arnold E, sion of AIDS-associated retrovirus from mother to infant. Hughes SH: Mutation of amino acids in the connection domain Lancet 1985, 1:896-898. of human immunodeficiency virus type 1 reverse tran- 5. Ahmad N: Molecular mechanisms of human immunodefi- scriptase that contact the template-primer affects RNase H ciency virus type 1 mother-infant transmission. Adv Pharmacol activity. J Virol 2003, 77:8548-8554. 2000, 49:387-416. 25. Julias JG, McWilliams MJ, Sarafianos SG, Arnold E, Hughes SH: Muta- 6. Blanche S, Rouzioux C, Moscato ML, Veber F, Mayaux MJ, Jacomet C, tions in the RNase H domain of HIV-1 reverse transcriptase Tricoire J, Deville A, Vial M, Firtion G: A prospective study of affect the initiation of DNA synthesis and the specificity of infants born to women seropositive for human immunodefi- RNase H cleavage in vivo. Proc Natl Acad Sci U S A 2002, ciency virus type 1. HIV Infection in Newborns French Col- 99:9515-9520. laborative Study Group. N Engl J Med 1989, 320:1643-1648. 26. Ding J, Jacobo-Molina A, Tantillo C, Lu X, Nanni RG, Arnold E: Bur- 7. Mok JQ, Giaquinto C, De Rossi A, Grosch-Worner I, Ades AE, Peck- ied surface analysis of HIV-1 reverse transcriptase p66/p51 ham CS: Infants born to mothers seropositive for human heterodimer and its interaction with dsDNA template/ immunodeficiency virus. Preliminary findings from a multi- primer. J Mol Recognit 1994, 7:157-161. centre European study. Lancet 1987, 1:1164-1168. 27. Gao G, Orlova M, Georgiadis MM, Hendrickson WA, Goff SP: Con- 8. Ryder RW, Nsa W, Hassig SE, Behets F, Rayfield M, Ekungola B, Nel- ferring RNA polymerase activity to a DNA polymerase: a son AM, Mulenda U, Francis H, Mwandagalirwa K: Perinatal trans- single residue in reverse transcriptase controls substrate mission of the human immunodeficiency virus type 1 to selection. Proc Natl Acad Sci U S A 1997, 94:407-411. infants of seropositive women in Zaire. N Engl J Med 1989, 28. Harris D, Kaushik N, Pandey PK, Yadav PN, Pandey VN: Functional 320:1637-1642. analysis of amino acid residues constituting the dNTP bind- 9. Gotte M, Li X, Wainberg MA: HIV-1 reverse transcription: a ing pocket of HIV-1 reverse transcriptase. J Biol Chem 1998, brief overview focused on structure-function relationships 273:33624-33634. among molecules involved in initiation of the reaction. Arch 29. Harris D, Yadav PN, Pandey VN: Loss of polymerase activity due Biochem Biophys 1999, 365:199-210. to Tyr to Phe substitution in the YMDD motif of human 10. Matala E, Crandall KA, Baker RC, Ahmad N: Limited heterogene- immunodeficiency virus type-1 reverse transcriptase is com- ity of HIV type 1 in infected mothers correlates with lack of pensated by Met to Val substitution within the same motif. vertical transmission. AIDS Res Hum Retroviruses 2000, Biochemistry 1998, 37:9630-9640. 16:1481-1489. 30. Boyer PL, Ferris AL, Hughes SH: Cassette mutagenesis of the 11. Larder BA, Kemp SD, Darby G: Related functional domains in reverse transcriptase of human immunodeficiency virus type virus DNA polymerases. Embo J 1987, 6:169-175. 1. J Virol 1992, 66:1031-1039. 12. Kamer G, Argos P: Primary structural comparison of RNA- 31. Chao SF, Chan VL, Juranka P, Kaplan AH, Swanstrom R, Hutchison dependent polymerases from plant, animal and bacterial CA 3rd: Mutational sensitivity patterns define critical resi- viruses. Nucleic Acids Res 1984, 12:7269-7282. dues in the palm subdomain of the reverse transcriptase of 13. Toh H, Hayashida H, Miyata T: Sequence homology between ret- human immunodeficiency virus type 1. Nucleic Acids Res 1995, roviral reverse transcriptase and putative polymerases of 23:803-810. hepatitis B virus and cauliflower mosaic virus. Nature 1983, 32. Mulky A, Sarafianos SG, Arnold E, Wu X, Kappes JC: Subunit-spe- 305:827-829. cific analysis of the human immunodeficiency virus type 1 14. Ding J, Hughes SH, Arnold E: Protein-nucleic acid interactions reverse transcriptase in vivo. J Virol 2004, 78:7089-7096. and DNA conformation in a complex of human immunode- 33. Huelsenbeck JP, Crandall KA: Phylogeny estimation and hypoth- ficiency virus type 1 reverse transcriptase with a double- esis testing using maximum likelihood. Annu Rev Ecol Sys stranded DNA template-primer. Biopolymers 1997, 44:125-138. 1997:437-466. 15. di Marzo Veronese F, Copeland TD, DeVico AL, Rahman R, Oroszlan 34. Swofford DI: PAUP* Phylogenetic analysis using parsimony S, Gallo RC, Sarngadharan MG: Characterization of highly immu- and other methods 4.0.0b2. Sinauer associated, Sunderland, MA; nogenic p66/p51 as the reverse transcriptase of HTLV-III/ 1999. LAV. Science 1986, 231:1289-1291. 35. Posada D, Crandall KA: MODELTEST: testing the model of 16. Gotte M, Maier G, Gross HJ, Heumann H: Localization of the DNA substitution. Bioinformatics 1998, 14:817-818. active site of HIV-1 reverse transcriptase-associated RNase 36. Nielsen R, Yang Z: Likelihood models for detecting positively H domain on a DNA template using site-specific generated selected amino acid sites and applications to the HIV-1 enve- hydroxyl radicals. J Biol Chem 1998, 273:10139-10146. lope gene. Genetics 1998, 148:929-936. 17. Hizi A, McGill C, Hughes SH: Expression of soluble, enzymati- 37. Yang Z: Phylogenetic Analysis of Maximum Likelihood cally active, human immunodeficiency virus reverse tran- (PAML). 3.0th edition. University College of London: London; 2000. scriptase in Escherichia coli and analysis of mutants. Proc Natl 38. Nei M, Gojobori T: Simple methods for estimating the num- Acad Sci U S A 1988, 85:1218-1222. bers of synonymous and nonsynonymous nucleotide 18. Prasad VR, Goff SP: Linker insertion mutagenesis of the human substitutions. Mol Biol Evol 1986, 3:418-426. immunodeficiency virus reverse transcriptase expressed in 39. Zanotto PM, Kallas EG, de Souza RF, Holmes EC: Genealogical evi- bacteria: definition of the minimal polymerase domain. Proc dence for positive selection in the nef gene of HIV-1. Genetics Natl Acad Sci U S A 1989, 86:3104-3108. 1999, 153:1077-1089. 19. Larder BA, Purifoy DJ, Powell KL, Darby G: Site-specific mutagen- 40. Hahn T, Ramakrishnan R, Ahmad N: Evaluation of genetic diver- esis of AIDS virus reverse transcriptase. Nature 1987, sity of human immunodeficiency virus type 1 NEF gene asso- 327:716-717. ciated with vertical transmission. J Biomed Sci 2003, 10:436-450. 20. Le Grice SF, Naas T, Wohlgensinger B, Schatz O: Subunit-selective 41. Jacobo-Molina A, Arnold E: HIV reverse transcriptase structure- mutagenesis indicates minimal polymerase activity in het- function relationships. Biochemistry 1991, 30:6351-6356. erodimer-associated p51 HIV-1 reverse transcriptase. Embo J 42. Sarafianos SG, Das K, Tantillo C, Clark AD Jr, Ding J, Whitcomb JM, 1991, 10:3905-3911. Boyer PL, Hughes SH, Arnold E: Crystal structure of HIV-1 21. Boyer PL, Ferris AL, Clark P, Whitmer J, Frank P, Tantillo C, Arnold reverse transcriptase in complex with a polypurine tract E, Hughes SH: Mutational analysis of the fingers and palm sub- RNA:DNA. Embo J 2001, 20:1449-1461. Page 16 of 17 (page number not for citation purposes)
  17. Retrovirology 2005, 2:36 http://www.retrovirology.com/content/2/1/36 43. Huang H, Chopra R, Verdine GL, Harrison SC: Structure of a cov- 57. Menendez-Arias L, Mas A, Domingo E: Cytotoxic T-lymphocyte alently trapped catalytic complex of HIV-1 reverse tran- responses to HIV-1 reverse transcriptase (review). Viral scriptase: implications for drug resistance. Science 1998, Immunol 1998, 11:167-181. 282:1669-1675. 58. Hahn T, Ahmad N: Genetic characterization of HIV type 1 gag 44. Boyer PL, Ding J, Arnold E, Hughes SH: Subunit specificity of p17 matrix genes in isolates from infected mothers lacking mutations that confer resistance to nonnucleoside inhibitors perinatal transmission. AIDS Res Hum Retroviruses 2001, in human immunodeficiency virus type 1 reverse 17:1673-1680. transcriptase. Antimicrob Agents Chemother 1994, 38:1909-1914. 59. Husain M, Hahn T, Yedavalli VR, Ahmad N: Characterization of 45. Cornelissen M, van den Burg R, Zorgdrager F, Lukashov V, Goudsmit HIV type 1 tat sequences associated with perinatal J: pol gene diversity of five human immunodeficiency virus transmission. AIDS Res Hum Retroviruses 2001, 17:765-773. type 1 subtypes: evidence for naturally occurring mutations 60. Yedavalli VR, Chappey C, Ahmad N: Maintenance of an intact that contribute to drug resistance, limited recombination human immunodeficiency virus type 1 vpr gene following patterns, and common ancestry for subtypes B and D. J Virol mother-to-infant transmission. J Virol 1998, 72:6937-6943. 1997, 71:6348-6358. 61. Yedavalli VR, Chappey C, Matala E, Ahmad N: Conservation of an 46. Vergne L, Peeters M, Mpoudi-Ngole E, Bourgeois A, Liegeois F, intact vif gene of human immunodeficiency virus type 1 dur- Toure-Kane C, Mboup S, Mulanga-Kabeya C, Saman E, Jourdan J, et ing maternal-fetal transmission. J Virol 1998, 72:1092-1102. al.: Genetic diversity of protease and reverse transcriptase 62. Yedavalli VR, Husain M, Horodner A, Ahmad N: Molecular charac- sequences in non-subtype-B human immunodeficiency virus terization of HIV type 1 vpu genes from mothers and infants type 1 strains: evidence of many minor drug resistance after perinatal transmission. AIDS Res Hum Retroviruses 2001, mutations in treatment-naive patients. J Clin Microbiol 2000, 17:1089-1098. 38:3919-3925. 63. Albert J, Wahlberg J, Leitner T, Escanilla D, Uhlen M: Analysis of a 47. Tantillo C, Ding J, Jacobo-Molina A, Nanni RG, Boyer PL, Hughes SH, rape case by direct sequencing of the human immunodefi- Pauwels R, Andries K, Janssen PA, Arnold E: Locations of anti- ciency virus type 1 pol and gag genes. J Virol 1994, 68:5918-5924. AIDS drug binding sites and resistance mutations in the 64. Holmes EC, Zhang LQ, Simmonds P, Rogers AS, Brown AJ: Molecu- three-dimensional structure of HIV-1 reverse transcriptase. lar investigation of human immunodeficiency virus (HIV) Implications for mechanisms of drug inhibition and infection in a patient of an HIV-infected surgeon. J Infect Dis resistance. J Mol Biol 1994, 243:369-387. 1993, 167:1411-1414. 48. Turner D, Brenner B, Wainberg MA: Relationships among vari- 65. Huang Y, Zhang L, Ho DD: Characterization of gag and pol ous nucleoside resistance-conferring mutations in the sequences from long-term survivors of human immunodefi- reverse transcriptase of HIV-1. J Antimicrob Chemother 2004, ciency virus type 1 infection. Virology 1998, 240:36-49. 53:53-57. 66. Korber BT, Learn G, Mullins JI, Hahn BH, Wolinsky S: Protecting 49. Turner D, Roldan A, Brenner B, Moisi D, Routy JP, Wainberg MA: HIV databases. Nature 1995, 378:242-244. Variability in the PR and RT genes of HIV-1 isolated from 67. Wolinsky SM, Korber BT, Neumann AU, Daniels M, Kunstman KJ, recently infected subjects. Antivir Chem Chemother 2004, Whetsell AJ, Furtado MR, Cao Y, Ho DD, Safrit JT: Adaptive evo- 15:255-259. lution of human immunodeficiency virus-type 1 during the 50. Shafer RW, Hsu P, Patick AK, Craig C, Brendel V: Identification of natural course of infection. Science 1996, 272:537-542. biased amino acid substitution patterns in human immuno- 68. Ahmad N, Baroudy BM, Baker RC, Chappey C: Genetic analysis of deficiency virus type 1 isolates from patients treated with human immunodeficiency virus type 1 envelope V3 region protease inhibitors. J Virol 1999, 73:6197-6202. isolates from mothers and infants after perinatal 51. Borrow P, Lewicki H, Wei X, Horwitz MS, Peffer N, Meyers H, Nel- transmission. J Virol 1995, 69:1001-1012. son JA, Gairin JE, Hahn BH, Oldstone MB, Shaw GM: Antiviral pres- 69. Hahn T, Matala E, Chappey C, Ahmad N: Characterization of sure exerted by HIV-1-specific cytotoxic T lymphocytes mother-infant HIV type 1 gag p17 sequences associated with (CTLs) during primary infection demonstrated by rapid perinatal transmission. AIDS Res Hum Retroviruses 1999, selection of CTL escape virus. Nat Med 1997, 3:205-211. 15:875-888. 52. Harrer T, Harrer E, Kalams SA, Barbosa P, Trocha A, Johnson RP, 70. Sabbaj S, Edwards BH, Ghosh MK, Semrau K, Cheelo S, Thea DM, Elbeik T, Feinberg MB, Buchbinder SP, Walker BD: Cytotoxic T Kuhn L, Ritter GD, Mulligan MJ, Goepfert PA, et al.: Human immu- lymphocytes in asymptomatic long-term nonprogressing nodeficiency virus-specific CD8(+) T cells in human breast HIV-1 infection. Breadth and specificity of the response and milk. J Virol 2002, 76:7365-7373. relation to in vivo viral quasispecies in a person with pro- 71. Matala E, Hahn T, Yedavalli VR, Ahmad N: Biological characteriza- longed infection and low viral load. J Immunol 1996, tion of HIV type 1 envelope V3 regions from mothers and 156:2616-2623. infants associated with perinatal transmission. AIDS Res Hum 53. Harrer T, Harrer E, Kalams SA, Elbeik T, Staprans SI, Feinberg MB, Retroviruses 2001, 17:1725-1735. Cao Y, Ho DD, Yilma T, Caliendo AM, et al.: Strong cytotoxic T 72. Akaike H: A new look at the statistical model identification. cell and weak neutralizing antibody responses in a subset of IEEE Trans Autom Contr 1974, 19:716-723. persons with stable nonprogressing HIV type 1 infection. AIDS Res Hum Retroviruses 1996, 12:585-592. 54. Klein MR, van Baalen CA, Holwerda AM, Kerkhof Garde SR, Bende RJ, Keet IP, Eeftinck-Schattenkerk JK, Osterhaus AD, Schuitemaker H, Miedema F: Kinetics of Gag-specific cytotoxic T lymphocyte responses during the clinical course of HIV-1 infection: a lon- gitudinal analysis of rapid progressors and long-term Publish with Bio Med Central and every asymptomatics. J Exp Med 1995, 181:1365-1372. scientist can read your work free of charge 55. Rinaldo CR Jr, Beltz LA, Huang XL, Gupta P, Fan Z, Torpey DJ 3rd: Anti-HIV type 1 cytotoxic T lymphocyte effector activity and "BioMed Central will be the most significant development for disease progression in the first 8 years of HIV type 1 infection disseminating the results of biomedical researc h in our lifetime." of homosexual men. AIDS Res Hum Retroviruses 1995, 11:481-489. Sir Paul Nurse, Cancer Research UK 56. Wilson CC, Brown RC, Korber BT, Wilkes BM, Ruhl DJ, Sakamoto D, Kunstman K, Luzuriaga K, Hanson IC, Widmayer SM, Wiznia A, Your research papers will be: Clapp S, Aman AJ, Koup RA, Wolinsky SM, Walker BD: Frequent available free of charge to the entire biomedical community detection of escape from cytotoxic T-lymphocyte recogni- tion in perinatal human immunodeficiency virus (HIV) type peer reviewed and published immediately upon acceptance 1 transmission: the ariel project for the prevention of trans- cited in PubMed and archived on PubMed Central mission of HIV from mother to infant. J Virol 1999, 73:3975-3985. yours — you keep the copyright BioMedcentral Submit your manuscript here: http://www.biomedcentral.com/info/publishing_adv.asp Page 17 of 17 (page number not for citation purposes)
ADSENSE

CÓ THỂ BẠN MUỐN DOWNLOAD

LV.11: Bộ Luận Văn Tốt Nghiệp Chuyên Ngành Tài Chính Ngân Hàng
172 tài liệu
829 lượt tải
THÔNG TIN
TRỢ GIÚP
HỖ TRỢ KHÁCH HÀNG
Theo dõi chúng tôi

Chịu trách nhiệm nội dung:

Nguyễn Công Hà - Giám đốc Công ty TNHH TÀI LIỆU TRỰC TUYẾN VI NA

LIÊN HỆ

Địa chỉ: P402, 54A Nơ Trang Long, Phường 14, Q.Bình Thạnh, TP.HCM

Hotline: 093 303 0098

Email: support@tailieu.vn

Giấy phép Mạng Xã Hội số: 670/GP-BTTTT cấp ngày 30/11/2015 Copyright © 2022-2032 TaiLieu.VN. All rights reserved.

 

Đồng bộ tài khoản
4=>1