Summary of Biotechnology doctoral thesis: Study on development of DNA barcodes and research on in vitro micropropagation of Paramignya trimera

Chia sẻ: _ _ | Ngày: | Loại File: PDF | Số trang:27

Thêm vào BST

Báo xấu

21
lượt xem 4
download

Download Vui lòng tải xuống để xem tài liệu đầy đủ

Thesis objectives: Evaluating the distribution of morphological characteristics, building a distribution map of the population of P. trimera and some species of the genus Paramignya; determining the genetic relationship of the P. trimera population by SSR markers; identification of DNA barcodes for identification of P. trimera; developed the protocol of in vitro micropropagation of P. trimera collected in Khanh Hoa, Vietnam.

Chủ đề:

Bình luận(0) Đăng nhập để gửi bình luận!

Lưu

Nội dung Text: Summary of Biotechnology doctoral thesis: Study on development of DNA barcodes and research on in vitro micropropagation of Paramignya trimera

MINISTRY OF EDUCATION AND VIETNAM ACADEMY TRAINING OF SCIENCE AND TECHNOLOGY GRADUATE UNIVERSITY SCIENCE AND TECHNOLOGY ----------------------------- Phi Thi Cam Mien Study on development of DNA barcodes and research on in vitro micropropagation of Paramignya trimera Specialized: Biotechnology Code number: 9.42.02.01 SUMMARY OF BIOTECHNOLOGY DOCTORAL THESIS Ha Noi, 2021
The thesis was completed at: Department Graduate University Science and Technology, Institute of Biotechnology Supervisor: Assoc.Prof. Dr Chu Hoang Ha Reviewer 1: … Reviewer 2: … Reviewer 3: …. The thesis will be defended at: ......................................................................................................................................... ......................................................................................................................................... Time: .............................................................................................................................. The thesis could be found at: National Library of VietNam Library of Graduate University Science and Technology Institute of Biotechnology
1 INTRODUCTION 1. Introduction The Paramignya trimera (Oliv.) Guill belonging to the family Rutaceae, distributed mainly in Khanh Hoa and Ninh Thuan provinces. According to published documents, Vietnam had 7 species of the genus Paramignya. P. trimera is a small woody, creeping, wild tree, distributed in areas over 200 meters, where has arid climate, thin topsoil. It has been widely used in traditional and folk medicine as an herbal plant for treating the liver diseases, blood pressure and cancer. Recently, many studies have shown that the root of P. trimera contains many alkaloids, saponins, courmarins and triterpenoids, which have effects on acute hepatitis and inhibited some cancer cell lines. In particular, P.trimera extract is so safe for use. Because of the highly effects of the P. trimera root for treating some cancer cell lines, the price of this root is very high, so its over exploited exhaustion. In addition, due to the high ability of cross-pollination and highly frequency mutations, combined with the phenomenon of asexual reproduction and polyploidy, the phenotype of P.trimera in nature is very diverse, with many similar characteristics with other plants in the genus Paramignya. The existence of such hybrids makes them difficult to distinguish and confusing based on only morphology. Its existence of many types of P.trimera such as outcrosses between closely related species of the genus Paramignya, so it is difficult to identify accurately to store, preserve and multi propagation to develop P.trimera area. Therefore, it is necessary to accurately identify the P.trimera species for future research, and developing the medicinal plant areas to multi propagation. So, the study "Study on development of DNA barcodes for identification and in vitro micropropagation of P. trimera" to accurately identify P. trimera species and propagate this species in order to conserve and effectively exploit this species of high medicinal value. 2. Thesis objectives - Evaluating the distribution of morphological characteristics, building a distribution map of the population of P. trimera and some species of the genus Paramignya - Determining the genetic relationship of the P. trimera population by SSR markers - Identification of DNA barcodes for identification of P. trimera - Developed the protocol of in vitro micropropagation of P. trimera collected in Khanh Hoa, Vietnam 3. Thesis contents - Investigate, collect and build a map of the distribution of the P.trimera population - Evaluation of the genetic diversity of the population of P.trimera and some species of the genus Paramignya by SSR - Research on building the DNA barcodes for identification of the P.trimera - Study an in vitro micropropagation to conservation of P.trimera species 4. Thesis contributions - Additional scientific data to identify the morphological characteristics and taxonomy of P.trimera in Khanh Hoa province - A database of DNA sequences for the P.trimera has been built and registered in NCBI, and initially developed DNA markers to make a foundation for the development of DNA barcodes. - - Contributing to creating a scientific basis for identification and conservation of genetic resources of P. trimera - Successfully building the in vitro micropropagation of P.trimera
2 5. Scientific and practical significance 5.1. Scientific - Constructed a the natural distribution map of some populations of P.trimera and some species of the genus Paramignya in Khanh Hoa and Lam Dong provinces. - Provide more nucleotide sequence data of ITS, matK and rbcL gene fragments of P.trimera and some species of Paramignya and register in GenBank (NCBI), creating a database for building DNA Barcode for identifies and distinguishes the P.trimera and related species in the genus Paramignya and the Rutaceae - Study results contribute to elucidating the morphological characteristics, genotype and phenotypic diversity of P.trimera in Khanh Hoa and Lam Dong provinces. - Determining the genetic relationship of P.trimera with some species of Paramignya genus, and builded the DNA barcodes for identification the P. trimera by matK marker. Provide scientific information on the in vitro propagation of P. trimera. 5.2. Practical significance - Through the a map of the natural distribution of the P. trimera, it helps to plan, orient, and develop the genetic resources of the P. trimera effectively. - From data of genetic relationship and DNA barcode for species identification of P. trimera. It’s can used for the hybrid and creating new species of P. trimera - Successfully built a protocol of in vitro micropropagation for P. trimera species, contributing the standard medicinal areas of P. trimera in Vietnam CHAPTER 1. LITERATURE REVIEWS The genus Paramignya belongs to the family Rutaceae, consisting of about 15 species in southern of Vietnam, southeastern Asia and northern Australia. According to the botanical taxonomy on the botanic database (theplantlist.org), the genus Paramignya includes 30 species. There are two species have accepted scientific names, P. confertifolia Swingle and P. rectispinosa W. G. Craib. The P. trimera is one of the 30 species of the Paramignya genus, of the Rutaceace family, distributed mainly in South Asia, Southeast Asia and northern Australia, India, Indonesia, the Philippines, East Timor, and Australia. In Vietnam, it was found in Tay Ninh, Khanh Hoa (Ninh Hoa), Ninh Thuan, and Phu Yen. Currently, only four species have been studied for their chemical composition at different levels. In which, there are 01 species collected in Sri Lanka (P. monophylla), 01 species in Thailand (P. griffithii) and 02 species in Vietnam (P. trimera, P. scandens). The main classes of substances in this genus include mainly coumarins, triterpenes, alkaloids and glycoside. Up to now, about 85 natural compounds have been isolated from the genus Paramignya, including 18 coumarins, 15 types of tirucallan and tirucallan saponins, 9 alkaloids, 11 flavanones and some other compounds. These biologically active substances have antioxidant effects, preventing the growth of cancer cells. P. trimera is an traditional medicinal plant that has the effect of treating liver diseases such as hepatitis, cirrhosis and liver cancer. Due to its effective pharmacological used in the treatment of many diseases, the root of P. trimera has been exploited over and is almost exhausted. Besides, Khanh Hoa appeared many kind of roots, it is not the root of P. trimera, some samples have different leaf and spine shapes, but still collected as P. trimera. Meanwhile, in Vietnam, there have not been any publications on morphological and molecular characteristics of this plant. Therefore, research to help identify morphologically and molecularly of P. trimera is a necessary, providing a database of this precious medicinal plant. In addition, in vitro propagation has built a conservation garden for the P. trimera of Khanh Hoa, Vietnam
3 CHAPTER 2. MATERIALS AND METHODS 2.1. Materials 2.1.1. Materials for the study of taxonomic and phylogenetic relationship of collected samples of P. trimera and some species of genus Paramignya The P. trimera samples consisted of 5 populations marked from X1 to X5 based on phenotypic differences. Samples of 4 species of the genus Paramignya include P. armata, P. monophylla, P. scandens, and P. rectispinosa. 2.1.2. Materials use for multi propagation of P. trimera. The materials used for the in vitro multiplication were the stem, callus, and seeds of the t P. trimera collected at Ba Ninh Co., Ltd., Ninh Van, Khanh Hoa. 2.1.3. SSR, ITS, matK, rbcL primers In this study 50 SSR primers were used and described by Froelicher and co-author in 2008, Corazza-Nunes and co-author in 2002, Barkley and co-author in 2006 provided by Bioneer. Table 2.2. Primer sequence of ITS, matK và rbcL Primer size Primers Sequences (5'-3') Source (bp) MatK (F) TAATTTACRATCAATTCATTCAATATTTCC Kyndt et al., 850 bp MatK (R) GARGAYCCRCTRTRATAATGAGAAAGATTT 2005 ITS (F) AGGAGAAGTCGTAACAAGGTTTCC Sun et al., ITS (R) GATATGCTTAAACTCAGCGGGTC 850 bp 1994 RbcL (F) ATGTCACCA CAAACAGAGACTAA 500 bp RbcL(R) TTCGGCACAAAATACGAAACGATCTCTC CBOL, 2009 2.2. Methods 2.2.1. Methods of investigation, collection and distribution map construction The investigation and collected the sample were carried out according to the method of Klein and Klein (1970) and Nguyen Nghia Thin (2007). Surveying areas in Khanh Hoa and Lam Dong revealed the original population and surrounding areas to further identify other distribution areas of the studied species. Based on the distribution of the original population, identify areas with the same belt and forest type within a radius of 50 km. With the identified areas, conduct survey routes on the map (on the map enlarge to a topographic map of 1:5,000 scale. In the detected areas, there is a distribution of the research species, record the characteristics of habitat conditions through descriptions, images and coordinate data from the GPS Map 60 CSX. Mark the location of the detection area with the distribution of the research species. The map is made in ArcGIS 10.30 software, using the software's built-in color display and grouping tools. 2.2.2. Morphological description method P. trimera Samples in Khanh Hoa were determined by the method of morphological comparison, compared with the taxonomic keys in the botanical (Pham Hoang Ho, 1999; Nguyen Nghia Thin, 2007) in the Department of Botany. Faculty of Agronomy, Vietnam National University of Agriculture. 2.2.3. Extraction and purification of total DNA Total DNA was extracted according to the method of Doyle (1990). The tissue samples after grinding will be broken the cell wall in CTAB extraction buffer (1.4 M NaCl; 0.1 M Tris- HCl pH 8; 20 mM EDTA pH 8; 2% CTAB) for 2 h at 65°C . The solution was then centrifuged to remove the cell residue and extracted with chloroform:isoamyl alcohol (24:1). The extract was treated with RNase and precipitated DNA using twice the volume of 100% EtOH; 0.3 M
4 CH3COONa for 3 h at -20°C. The DNA precipitate was washed with 70% EtOH, dried and dissolved in sterile deionized water. DNA quality was checked by electrophoresis in 1% agarose and quantified using Nanodrop (Eppendorf, USA). 2.2.4. PCR microsatellite regions using SSR markers PCR product with 50 pairs of SSR primers specific to the Rutaceae. The temperature and time of the primer were experimentally corrected to obtain stable and specific bands. PCR products were run on polyacrylamide gel electrophoresis (SDS-PAGE) at 8% concentration and stained with ethyl bromide as described by Halima Benbouza et al (Halima Benbouza, 2006). Standard scale (Thermo Scientific™ O'GeneRuler DNA Ladder, Ready-to-Use 50-1000 bp) from G-BIOSCIENCES. 2.2.5. PCR multiplies the marker regions The extracted total DNA was used as a template for PCR with primer pairs ITS, matK and rbcL. Components PCR reaction was conducted with a volume of 20 µL including: 1X DreamTaq Buffer; 1 mM dNTPs; 2.5 μM per primer; 0.75 units of DreamTaq DNA polymerase; 50 ng of total DNA. PCR was performed with the following thermal cycling: 94˚C/4 min; (94˚C/ 30 s; 53-57˚C/ 30 s; 72˚C/ 45 s x 30 cycles, 72˚C /7 min, then kept at 15˚C. Temperature and time of priming. were experimentally adjusted to obtain specific PCR products.The PCR products were checked by electrophoresis on 0.8% agarose gel. Molecular markers ITS, matK, rbcL after PCR multiplication with similar primer pairs was checked by 1% agarose gel electrophoresis on a standard scale (Thermo Scientific™ GeneRuler 1 kb DNA Ladder, ready-to-use) 2.2.6. Sequencing and Registering Sequences The purified PCR product was direct sequencing in both directions by Macrogen, Korea. The DNA sequences after sequencing were corrected and removed for noise with the help of ChromasPro2.1.6 software (Technelysium, 2013) and compared with those on Genbank. Sequences were aligned using Bioedit v7.0.5.2 software (Hall, 1999). The noisy samples with indistinct peaks were subjected to PCR and re-read until a clear signal was obtained. Sequences were published on Genbank using NCBI's BankIt tool. 2.2.7. Sequence data analysis method 2.2.7.1. Analysis of genetic diversity by using SSR Analysis of SSR markers was performed using Power Marker 3.25 software to export data in binary format (presence of allele = “1” and absence of allen = “0”). Binary data was used for subsequent analysis with the NTSYS-pc version 2.1 program. The similarity matrix between the analytes was calculated with the “Simqual” subroutine using the DICE coefficient, followed by a cluster analysis with the SAHN subroutine using the UPGMA clustering method using NTSYS. - pc. Statistical processing includes number of alleles per locus, allele frequency, polymorphic alleles, PIC value. The genetic distance was calculated using the formula of "Nei 1983" (Nei, 1983). 2.2.7.2. Maximum-Likelihood (ML) analysis Evolutionary trees were built based on multiple sequence using the MEGA-X program (Version 10.1.7) applying the Kimura-2 (K2P) model. The rate of change of nucleotides in the sequence was calculated uniformly at all positions. Evolution trees are built based on character analysis using the maximum likelihood algorithm (ML) with a bootstrap value of 1000. The evolutionary tree with the highest probability consists of taxonized units. cluster
5 groups together are selected and show % values in branches. Gaps and missing data were selected with a value of 95%. 2.2.7.3. Bayesian interference analysis method The program BEAST v2.6.3 (running on Mac platform) uses Bayesian inference (BI) to build the corresponding evolutionary tree with the same data set. The Nexus format alignment file is used as input to the BEAUTi 2 program with the Site model (Gamma site model), Clock model (Strick clock) and Prior (Coalescant Bayesian Skyline) parameters. The file generated in *.xmL format is used as the input file for BEAST v2.6.3 with the BEAGLE library. The program FigTree.v1.4.4 is used to display the tree. 2.2.7.4. Methods for constructing DNA barcode markers On the basis of the researches of Tanzeem Fatima and Cheng-Hong Yang, the process of building a DNA barcode to identify the P. trimera which is carried out according to the following basic steps: - Collecting samples of P. trimera and some species of Paramignya genus and accurately identifying species based on morphological and taxonomy - Extract DNA from collected samples and select markers to multiply DNA regions by PCR and determine nucleotide sequences. In this study, the ITS, MatK and rbcL sequences were selected using the universal primers. - Using Megablast tool to identify species based on reference sequences in GenBank. - Test the ability to distinguish the species of the selected sequence regions by analyzing the evolutionary tree. Evolution tree is built based on character based method in which 2 programs MegaX (using Maximum likelihood (ML) with K2P evolution model and BEAST program (using algorithm). Bayesian inference and the Prior Coalescant Bayesian Skyline model). Sequence regions that generate separate branches in the evolutionary tree will be selected as barcoding sequences for species identification. - Using the tool to align multiple sequences together to identify the specific sequence regions and have the ability to distinguish species to build molecular markers for species identification. Analysis to determine the common sequence region (consensus) among the selected sequences to identify the distinct and distinctive positions of the P. trimera with other species of the genus Paramignya. 2.2.7.5. Determining the general sequence (consensus) and the specific sequence of the P. trimera The consensus is the common sequence of all the analyzed sequences. The general sequence is inferred from the result of rooting multiple sequences. The Mega Align Pro tool of the program DNAStar Version: 17.1.1 (120) uses MUSCLE and Clustal Omega algorithms. 2.2.7.6. Determine barcode Gap Determination of the barcoding gap between the species analyzed is a method to assess the ability to develop barcoded DNA to distinguish species. Barcode DNA gap was determined by ExcaliBAR program based on distance matrix previously calculated using Mega-X software. The distance of the DNA barcodes was calculated based on the difference between the maximum intraspecific distance (maximum intraspecific distance) and the smallest distance between different species. The ABGD program, accessible at http://wwwabi.snv.jussieu.fr/public/abgd/abgdweb.htmL) is used to generate distance
6 histograms and distance ratings. (distance ranks) with 2 X values for the relative width between the distances of the DNA barcodes (1.0 and 1.5) and the distance calculated by the K2P model. Default values are used for all other parameters, the probability of intraspecific divergence P (prior intraspecific divergence) is set to range from 0.001 to 0.1 while the Steps value is set to default. 10, and Nb bins (to calculate the distance distribution) is set to 20. 2.3. In vitro micropropagation of P. trimera methods 2.3.1. Sterilization methods Stem material: Stem (40 cm) (from the tip) were collected. The branches were washed under distilled water and washed with soap for 10 minutes, rinsed 3-4 times with sterile distilled water and placed in a sterile incubator. Into aseptic incubator, the stem sample was cut into many small segments and disinfected with 2.5% Johnson and nano silver for different time periods to create a clean sample from the stem segment. Fruit material: After collection, the fruit was washed with soap for 10 minutes, rinsed 2-3 times with distilled water, rinsed again in etanol 70% for 30 seconds and moved to incubator. The P. trimera fruit was disinfected with nano silver, jonhson 2.5%. The seeds after separation were shaken in 1% Johnson solution for 3 minutes, rinsed 1-2 times with sterile distilled water and inoculated into MS medium to create a clean seed from the fruit. 2.3.2. Effect of basal media on the growth of P. trimera in in vitro conditions Three basal media (MS, WPM and Knudson) were used to determine the most suitable media for the growth and rapid multiplication of P. trimera; pH 5.6. All experiments were supplemented with 7 g/l agar, autoclaved at 121°C for 20 min. Experimental results were evaluated after 4 weeks. 2.3.3. Research on callus induction The source of samples used to create callus is cotyledon from the seeds of P.trimera after sterilization. The sterilized cotyledons were cut into small pieces and inoculated into medium supplemented with auxin (IAA, IBA, 2.4D and TDZ) with different concentrations (from 0.1 to 3.0 mg/l), sucrose (from 0.1 to 3.0 mg/l). 20 g/l), pH 5.8, all experiments were supplemented with 7 g/l agar, autoclaved at 121°C for 20 min. Experimental results are evaluated after 4-6 weeks. 2.3.4. Effects of cytokinins, and auxins on the proliferation and growth of P. trimera Sources of materials used for shoot induction. The study on shoot induction of P. trimera was carried out in the medium supplemented with cytokinin such as BA (1.0 - 5.0 mg/l), TDZ (0 - 0.5 mg/l) and a combination of two phytohormones with different concentrations (from 0.1 - 3.0 mg/l), sucrose (20 g/l), pH 5.8, all experiments were supplemented with 7 g/l agar, autoclaved at 121°C for 20 min. 2.3.5. Effect of auxin group on root formation The roots of P.trimera were induced in medium supplemented with auxin (IBA, α-NAA) with different concentrations (from 0.1 to 3.0 mg/l), sucrose (20 g/l), pH 5.8. All experiments were supplemented with 7 g/l agar, autoclaved at 121°C for 20 min. Experimental results were evaluated after 8 weeks. 2.3.6. Statistical analysis The experiments were arranged rapidly, with three replicates, 10 samples each time. Samples were grown in 250 ml glass flasks. Data were collected every week, including the infected rate, the callus induction rate, the shoots formation rate, and the rooting formation rate The shoot characteristics, number of shoots, number of root, shoot quality, root characteristics, root quality and callus quality were recorded. The data were processed using excel software, Duncan test and IRRISTAT 5.0.
7 CHAPTER 3. RESULTS AND DISCUSSION 3.1. DISTRIBUTION SURVEYING AND MORPHOLOGICAL FEATURES OF THE PARAMIGNYA SPECIES IN KHANH HOA AND LAM DONG 3.1.1. Survey the composition and distribution species of Paramignya The survey results in Khanh Hoa and Lam Dong areas obtained many individuals of P. trimera species and some individuals of 4 species of P. armata, P. scandens, P. monophylla and P. rectispionisa. After surveying, collecting, describing and marking distribution locations, the samples were classified into 5 large groups including the P. trimera group (X1, X2, X3, X4, X5) and 4 groups belong to 4 species of the genus Paramignya including P. armata, P. monophylla, P. scandens and P. rectispinosa (Figure 3.3 - 3.8). The samples after collection are marked and recorded data including the number of samples collected, coordinates, frequency of sample detection around the sample detection point, origin and address of the collected sample. The total number of samples collected from 9 groups of includes 50 individuals. In which, there are 29 specimens of P. trimera species divided into 5 groups marked X1 to X5 based on morphological differences (Figure 3.4), 5 individuals belonging to species P. armata, 6 individuals belonging to species P. monophylla, 5 individuals of P. scandens and 5 samples of P. rectispinosa. A B Fig 3.1/3.2/3.3. Map of the sample site collection and distribution status (A) and samples collecting location (B) of P. trimera and some other species of the genus Paramignya 3.1.2. Morphological characteristics of collected samples belonging to genus Paramignya Fig 3.4. Morphological characteristics of Paramignya trimera (Oliv.) Burkill (A) Shrubs 1-4 meters or over; (B): The tree is in bloom; (C): Typical floral structure; (D): Green fruit; (E): Ripe fruit. (F): Anatomy of a fruit with 2 seeds covered by a mucous membrane.
8 Figure 3.5. Diversity in leaf morphology of P. trimera (Oliv.) Burkill (A): Diversity in leaf shape of 5 groups of individuals of P.trimera collected in Ninh Van, Ninh Hoa, and Dien Khanh areas, denoted by P. trimera X1 to X5. (B): different leaf forms on the plant (C): Different leaf forms: (i) elongated (oblong) with long tips, (ii) with different forms, bulging in the middle and constricting at the ends (obovate) , oval, oval, elliptical, slightly rounded, leaf apex rounded or lobed at apex. (D): The different morphologies of the P.trimera Fig 3.6-3.9 Morphological characteristics of four species of 3.6 3.7 P. armata var. andamanica King; P. monophylla (Lour.) Tanaka; P. scandens; P. rectispinosa 3.8 3.9 3.2. DNA extraction, multiplication of DNA marker regions and species identification 3.2.1. Extraction, purification and determination of DNA The results have isolated the DNA of all collected samples including P. trimera, P. monophylla, P. armata, P. scandens and P. rectispinosa. The total DNA of the samples was checked by electrophoresis on 1% agarose gel (Figure 3.10). Fig 3.10. Total DNA of P.trimera and four species of Paramignya genus Notes: 1 - 5: P. trimera X1 - X5; 6 - 8: P. monophylla; 9 - 11: P. scandens; 12 - 13: P. rectispinosa; 14 - 17: P. armata. Total DNA after testing on agarose gel that was purified using Thermo Scientific GeneJET genome DNA purification kit (#K0722) and quantified by Nanodrop (Eppendorf, USA) as a basis for concentration determination. DNA template for subsequent PCR reactions. 3.2. Determination of genetic diversity of P. trimera samples by SSR Fifty (50) primers were surveyed, 31 were successfully multiplied and had repeatability with 115 amplified alleles, including 40 polymorphic bands. Some images analyzed by SSR r are presented in Figure 3.11. Fig 3.11. Results of polymorphism analysis of Paramignya samples by SSR The level of polymorphism in the population of the genus Paramignya is quite low, with an average of 2.88 allele/indicator. The polymorphic information content (PIC) of the markers ranged from 0.117 to 0.63. Particularly, P. armata species was significantly different from the analyzed species in the genus Paramignya when analyzed by primer pairs Ci01A07, Ci02A04,
9 Ci02B07, Ci02B10, mCrCIR01D06a. Among 31 primer pairs, 11 primer pairs showed high polymorphism with PIC value > 0.5. The results of the analysis are summarized in Table 3.2. Table 3.2. Number allen and coefficient PIC của 31 cặp mồi SSR Number of Primer Sequence (motif) Total allen PIC polymorphic alleles Ci01A07 (CT)9 2 1 0,113 Ci01C07 (CT)10 3 1 0,117 Ci01D11 (CT)15 3 2 0,269 Ci01D12 (CT)15 2 1 0,198 Ci01G11 (TGC) 11 1 0 0,009 Ci02A04 (GA)9 4 1 0,493 Ci02F07 (GT)7 4 1 0,235 Ci06A05b (GA)15 4 1 0,471 Ci07C09 (GT)15AT(GT)2 6 2 0,518 Ci07E06 (GA)9G(GA)2 4 2 0,531 Ci07D10 (GA)9G(GA)2 1 0 0,007 Ci07G07 (GA)19 2 1 0,198 Ci08C05 (GA)14 2 1 0,169 mCrCIR01B10 (TC)9CC(TC)2 4 1 0,549 mCrCIR01F04a (CA)12 4 2 0,447 mCrCIR01F04a (CT)13CC(CT)7 4 1 0,332 mCrCIR06A02 (GT)7 2 1 0,294 mCrCIR06A03 (GA)13 4 2 0,517 mCrCIR06A08 (GA)4A2(GA)2 A2(GA)9 4 1 0,352 Pr34 (AG)21 4 2 0,428 Pr35 (AG)21 2 1 0,198 Pr36 (GA)9 4 1 0,367 Pr37 (CT)12 2 1 0,238 Pr38 (CAC)23 4 1 0,457 Pr39 (AGT)14 4 1 0,523 Pr40 (ATC)9 1 0 0,008 Pr41 (AG)14 4 1 0,535 Pr44 (ATC)9 4 1 0,617 Pr43 (CAG)20 6 2 0,63 Pr45 (GT)23 4 1 0,398 Pr46 (CT)23 1 0 0,007 Pr47 (CT)19 1 0 0,008 Pr48 (CT)21 4 1 0,602 Pr49 (AG)14 4 2 0,608 Pr50 (GT)8 6 3 0,509 Total 115 40 The genetic relationship between species of the genus Paramignya was analyzed using NTSYS 2.1 software, thereby determining the genetic similarity coefficient and genetic tree of the analyzed species (Figures 3.12 and 3.13). The results showed that the cladogram tree showed two distinct branches of Paramignya species, in which the first branch included
10 P. trimera, P. monophylla, P. scandens and P. rectispinosa species, the second branch included P. armata. For the first branch, it is divided into 3 sub-clades, in which P. monophylla species is closely related to P. trimera species (X1-X4) with very small genetic distance from 0.001 to 0.009 (Figure 3.12). Fig 3.12. Genetic relationships of species of the genus Paramignya The results of the matrix analysis showed that the genetic distance between the analyzed samples was very small, ranging from 0.001 to 0.09 (Figure 3.13). Hình 3.13. Matrix of distances between analyzed samples The distance between species of the genus Paramignya is very small and there is an interweaving between different species in the same clade. This is also one of the reasons leading to the phenomenon of morphological similarity observed in nature, which can lead to the possibility of cross-breeding or interspecific outcrossing that can occur in different species in the same genus Paramignya. 3.3. PCR and sequencing of DNA marker regions and species identification 3.3.1. PCR and sequencing of DNA bacodes regions In this study, Paramignya samples were multiplied by PCR using common primer pairs including ITS, matK and rbcL. The results showed that the ITS, matK and rbcL regions were about 900, 900 and 620 nucleotides in long, respectively. PCR results multiplying ITS, matK and rbcL sequence regions of some representative samples are presented in Figure 3.14.
11 Figure 3.14. ITS, matK and rbcL multiplication results in Paramignya Note: A: Electrophoresis of PCR products with ITS primer of P. trimera X1 - X5 and P. armata, P. monophylla, P. scandens and P. rectispinosa, respectively, from wells 1 to 9 ; B: Electrophoresis of PCR products with matK primer of P.trimera X1 - X3, P. armata, P. monophylla, P. scandens and P. rectispinosa, respectively, wells from 1 to 7; C: Electrophoresis of PCR products with matK primer of P. trimera X1, P. trimera X2, P. armata, P. monophylla, P. scandens and P. rectispinosa, respectively, wells 1 - 6. M: Standard 1kb DNA ladder (1% agarose gel electrophoresis). 3.3.2. Species identification based on MEGABLAST 3.3.2.1. Species identification based on ITS sequences Megablast results in the ITS sequence region with the length of 715 nucleotides gave the best matching results with 2 sequences of P. trimera (KM111544.1) in Vinh Phuong, Khanh Hoa and sequences of P. confertifolia (HG004846.1) in Yunnan, Mensong, China. The results showed that the ITS query sequences of the samples belonging to the genus Paramignya were matched with a high similarity > 84.35%, query coverage from 93-98% with species belonging to the genus Paramignya such as P. armata, P. trimera, Severinia buxifolia, P. confertifolia, Citrus trifolia, Citrus sinnesis, Citrus reticulata and a hybrid between Citrus and tangelo (Figure 3.15). Figure 3.15. Megablast results using ITS query sequence of P. trimera X1 Note: Sequences 1-3 and 4-6 are ITS sequences registered in GenBank of this study Thus, by using the ITS primer in this study to multiply the ITS sequence region and this sequence region is capable of serving as a DNA barcode to identify the genus Paramignya with other genera. 3.3.2.2. Species identification based on matK sequence of P. trimera X1 Megablast results show that the first pairing results with species of the genus Paramignya, such as P. confertifolia (HG004970.1) in Yunnan, China was 99.48% and sequences of P. lobata species. (AB762387.1) was similar 99.48%. The matK sequence of a species of P. lobata with a counter number is 1402 nucleotides with 99.48% similarity and 99% query cover (Figure 3.17). The results show that the matK sequences of P. trimera (represented as P. trimera X1) are in a separate clade and are closely related to P. confertiforlia and P. lobata and also belong to large group which includes four species (polyphyletic group). Thus, the
12 matK sequence can identify and distinguish P. trimera species from other Paramignya species including P. confertifolia, P. lobata. Figure 3.17. Megablast results using the matK query sequence of P. trimera X1 3.3.2.2. Species identification based on rbcL sequence Megablast results matching rbcL sequences with sequences of Murrays paniculata, P. confertifolia, Atalantia kwangtungensis and several species of the genus Citrus (Figure 3.19). In which Megablast of M. paniculata (access number MT747442.1) results with Max score and Total score (974), query sequence coverage (91%) and similarity reached 98.55%. For P. confertifolia species with Max score and Total score (970), the coverage for the query sequence was 88%, and the similarity reached 99.26%. So the rbcL sequence of P. trimera species currently does not have a reference sequence in NCBI, this result suggests that with the marker rbcL, P. trimera is closely related to species of P. confertifolia, Murraya paniculata, Citrus polytrifolia. Figure 3.19. Megablast results with rbcL query sequence of P. trimera X1 According to the obtained results, the ITS, matK and rbcL regions allow differentiation at the Paramignya genus level. This means that species can be identified and distinguished at the level of the genus Paramignya. 3.4. Construction of a DNA barcode for the identification of the P.trimera 3.4.1. Survey of barcoded DNA data of species of the genus Paramignya Until September, 2020, in the BOLD system recorded 10 records of 4 species including P.cf. scandens, P. mindanaensis, P. lobata and P. confertifolia. In which, the officially published barcoded DNA data are located in the region of matK and rbcL genes. Detailed information is presented in Table 3.3. Table 3.3. DNA barcodes of species of the genus Paramignya in the BOLD system DNA barcodes No. Species Sign Taxonomy ID Collected place Size (bp) MatK rbcL 1 P. cf. scandens CRCZ1945-16 Rutaceae, Paramignya KR1943 Jambi, Indonesia 629 579 2 P. cf. scandens CRCZ1946-16 Rutaceae, Paramignya KR1944 Jambi, Indonesia 609 552 3 P. cf. scandens CRCZ1947-16 Rutaceae, Paramignya KR4713 Jambi, Indonesia - - 4 P. mindanaensis CRCZ4713-16 Rutaceae, Paramignya KR4711 Jambi, Indonesia - - 5 P. mindanaensis CRCZ4714-16 Rutaceae, Paramignya KR4712 Indonesia, Jambi - - 6 P. mindanaensis CRCZ4715-16 Rutaceae, Paramignya KR4713 Indonesia, Jambi - - 7 P. lobata GBVK1148-11 Rutaceae, Paramignya AB505913 GenBank, NCBI - 1680 8 P. confertifolia GBVP2397-14 Rutaceae, Paramignya HG004970 GenBank, NCBI 807 - 9 P. lobata GBVR1595-13 Rutaceae, Paramignya AB762387 GenBank, NCBI 1527 - 10 P. confertifolia GBVY3119-14 Rutaceae, Paramignya KF181542 China, Yunnan, Mengsong - 660 Note (-): N/A
13 3.4.2. Building a database of sequences belonging to the genus Paramignya In the nucleotide database, the number of reference DNA sequences belonging to the ITS, MatK, and rbcL regions is only about 30 sequences registered in GenBank. In order to develop a DNA molecular marker to identify and distinguish P.trimera species of the genus Paramignya, a separate database set for the genus Paramignya was built based on the results of sequence screening related to the species of the genus Paramignya are present in GenBank. Sequences with a high degree of similarity with query sequences belonging to the genus Paramignya from GenBank will be saved for database creation. The ITS, matK and rbcL sequences from this study are summarized in Table 3.4. Table 3.4. Sequence data of the species of the genus Paramignya Sequence information and access number in GenBank Species Site Note ITS Size matK Size rbcL Size P. armata var. Ninh Van, MT193825.1 767 MT215526 831 MT215536 604 This andamanica Khanh Hoa research King P. scandens Di Linh, MT193832.1 772 MT215519 831 MT215530 604 This Lam Dong research P. Cat Tien, MT193830.1 776 MT215518 831 MT215535 604 This rectispinosa Lam Dong research Craib Paramignya Ninh Van, MT193826.1 767 MT215522 831 MT215529 604 This trimera (Oliv.) Khanh Hoa MT193827.1 MT215524 MT215528 research Burkill (X1-X2) Ninh Hoa, MT193831.1 767 MT215523 831 MT215533 604 This Khanh Hoa MT193833.1 MT215525 MT215532 research (X3-X4) Dien Khanh, MT193834.1 767 MT215521 831 MT215534 604 This Khanh Hoa research (X5) P. monophylla Don Duong, MT193828.1 778 MT215517 831 MT215527 604 This Wright Lam Dong research Paramignya GBVR1595- - - AB762387 1527 - 1680 BOLD/Ge lobata 13/BOLD nBank system Paramignya GBVP2397- - - HG004970 807 - - BOLD/Ge confertifolia 14/BOLD nBank system Paramignya CRCZ1946- - - KR1944 609 - 552 BOLD cf. scandens 16/BOLD system Paramignya CRCZ1945- - - KR1944 629 - 579 BOLD cf. scandens 16/BOLD system Paramignya GBVY3119- - - - - KF181542 660 BOLD/Ge confertifolia 14 nBank 3.4.3. Compare sequences to identify and distinguish P.trimera When comparing the ITS, matK and rbcL gene regions of each individual belonging to each group P. armata, P. rectispinosa, P. scandens and P. monophylla, there was no difference in nucleotide sequences. This proves that the collected samples are homogenous and belong to the same species. However, when comparing the sequences of each individual of P.trimera belonging to groups X1-X5, although there is a very high similarity, there are still some differences in the
14 sequence. Therefore, the ITS, matK and rbcL sequences correspond to 5 representative samples of the P.trimera (P. trimera X1-X5) and 4 samples representing 4 species of P. trimera, P. rectispinosa, P. scandens and P. monophylla were selected for multiple sequencing using EMBL- EBI's Clustal Omega tool (https://www.ebi.ac.uk/Tools/msa/clustalo/). The results of multiple sequencing showed that, for the ITS sequence, with total of 715 nucleotides, the results of multiple sequencing showed that there were 320 identical nucleotides (*), accounting for 44.75%. For matK sequence, out of a total of 774 nucleotides, 131 nucleotides are completely identical, accounting for 16.92%. Similarly, the results of multiple sequence alignment for the rbcL region showed that, out of a total of 570 nucleotides, there are 161 identical nucleotides, accounting for 28.25%. 3.4.4. Building an evolutionary tree 3.4.4.1. Building an evolutionary tree from the ITS sequence The evolutionary tree built from the ITS sequence using the ML algorithm shows that there is overlap between the samples in the genus Paramignya. In which, sequences belonging to group P. trimera X1, X3 are located in the same clade with P. trimera species with access number KM111544.1 collected in Vinh Phuong, Khanh Hoa by research group Thien, V.H., Khanh, N.D. and Nam, TN published in 2014. The remaining samples P. trimera X2, X4 and X5 in the same clade, are closely related to 2 species of P. monophylla, P. rectispinosa and P. scandens. This clade shares a common ancestor with P. confertifolia (HG004846.1) in Yunna Mensong, China (Figure 3.21a). Figure 3.21a. The evolutionary relationship between species of the genus Paramignya is based on ITS sequence analysis using the ML algorithm of the MegaX program and the BEAST program (b). The BEAST program using the Bayesian inference shows that there is still an overlap between samples in the genus Paramignya. In which, the sequences of the samples in the group P. trimera X3, X4 and X5 are in the same clade, the sequences of the samples in the group P. trimera X1 and X2 are in the same group with P. monophylla and P. confertifolia (HG004846.1) in Yunnan, Mensong, China. While the other clade consisting of three species of P. rectispinosa, P. armata, P. scandens and P. trimera (KM111544.1) in Vinh Phuong, Khanh Hoa (Figure 3.21b). Thus, for ITS sequencing, when using both MegaX and BEAST programs, the P. trimera samples were still mixed with other species of the genus Paramignya. This suggests that, the ITS sequence can be used to identify P. trimera. But this is still confused with some close species of this genus, such as P. monophylla or P. Confertifolia. 3.4.4.2. Building an evolutionary tree from the matK sequence The results of building the evolutionary tree from matK sequence by ML algorithm show that there is a clear separation between the P. trimera samples and other species of the genus
15 Paramignya. In which, sequences belonging to group P. trimera X1 - X5 are in the same group (monophyletic group). Species P. monophylla, P. rectispinosa, P. scandens and P. armata are in the same group (polyphyletic group). Two species of P. confertifolia (HG004970.1) in Yunna Mengsong, China and P. scandens (EF138912.1) in Australia are in the same group (Figure 3.22a). Figure 3.22a/b. The evolutionary relationship between species of the genus Paramignya is based on matK sequence analysis using the ML algorithm of the MegaX program (a) and the BEAST program (b). For the BEAST program, the sequences of the P. trimera X1 - X5 belong into a large group (polyphyletic group) separate from the other species of Paramignya. In this large group, the P. trimera X1 - X4 samples are in a monophyletic group, the P. trimera X5 samples separate into a clade but share a common ancestor. The species P. monophylla, P. rectispinosa, P. scandens and P. armata together with P. confertifolia (HG004970.1) from Yunnan, Mengsong, China) belong to a large group (polyphyletic group). Particularly, P. scandens species originating from Australia was separated into an out group (Figure 3.22b). Thus, for matK sequences, using both MegaX and BEAST programs, the results were similar, in which the P. trimera species were in the same group separate from the other species of Paramignya genus. The results show that matK sequence can be used as an indicator to identify P. trimera from other species in the genus Paramignya. 3.4.4.3. Building an evolutionary tree using the sequence rbcL Similarly, the results of building evolutionary tree from rbcL sequence by ML algorithm show that there is an overlap between P. trimera samples X1, X2 and X4 with samples P. scandens and P. armata. This demonstrates that the rbcL sequence has a high degree of similarity between these species. The species P. rectispinosa and P. confertifolia (KF18542.1) in Yunna Mensong, China were separated into two clades in a polyphyletic group. Particularly, 4 species of Severinia buxifolia (AB505912.1) in Japan and 3 species of P. monophylla (AF320881.1), P. scandens (EF126562.1) and P. monophylla (AF320881.1.) in Australia are distributed in one clade. large (polyphyletic group). Apparently, Severinia buxifolia (AB505912.1) in Japan is a species of the genus Severinia, which should have been separated into a clade. This is also consistent with the taxonomic position of this genus in the family Rutaceae (Figure 3.23a).
16 Figure 3.23a/b. Evolutionary relationships between species of the genus Paramignya based on rbcL sequence analysis using the MegaX program (a) and the BEAST program (b). For the BEAST program using the Bayesian inference statistical algorithm (Figure 2.23b), the sequences of the P. trimera X1, X3, X5 group samples distributed in the same clade with P. scandens and P. monophylla AF320881.1 originated in Australia. The two samples P. trimera X2 and X4 belong to a large clade (polyphyletic group) consisting of 9 species, of which 1 clade (monophyletic group) includes 2 species of Severinia buxifolia (AB505912.1) originating from Japan and P. monophyla, One clade (monophyletic group) includes 2 species P. armata and P. rectispinosa, one clade (polyphyletic group) includes 4 species including P. trimera X2, X4 with 3 species P. lobata (EF126561.1) and P. scandens (EF126562) in Australia and P. confertifolia (KF182542.1) from Yunnan, Mensong, China (Figure 3.23b). Thus, for the rbcL sequence when using both MegaX and BEAST programs, it was shown that there was a cross between P. trimera samples with other species of the genus Paramignya. This shows that the ability to use rbcL sequence as an indicator for identification of P. trimera is still likely to be confused with some close species of the same genus such as P. monophylla or P. scandens. 3.4.5. Construction of DNA barcode for the identification of P.trimera 3.4.5.1. ITS Sequence Analysis The analysis results of the ITS sequence region consisting of 715 nucleotides of the species of the genus Paramignya show that the common sequence region (consensus) is calculated based on the frequency of occurrence of nucleotides in each common position of all sequences. When reviewing the whole sequence, there are 4 distinct nucleotide positions specific to the ITS sequence, including 2 positions 109 and 110, 2 nucleotides inserted CT (109_110insCT) appeared, at position 130 inserting nuceotide C. (130insC), at position 231 insert C or G (231insC/G) and at position 266 insert C (266 insC). The results of distinct nucleotide regions specific to P. trimera species are presented in Figure 3.24. The results of the ITS sequence analysis showed that there was still an overlap in sequence between P. trimera and P. monophylla at positions 109 and 110 with 2 additional nucleotides CT and position 266 co-occurs C nucleotides with species P. amarta, P. trimera X1, X2, X4. Therefore, the ITS gene is not reliable enough to make barcoded DNA to identify P. trimera species.
17 Figure 3.24. Analysis of distinct nucleotide regions/sites specific of P. trimera in the ITS . sequence 3.4.5.2. matK sequence analysis Similarly, the analysis results of matK sequence region was 774 nucleotide belong to some species of the genus Paramignya which provide a common sequence region. When scanning the entire sequence, there are 3 distinct nucleotide positions specific to the matK sequence including position 703 and 704 difference losing 2 nucleotides AA (703_704delAA), position 717 and 718 difference losing 2 nucleotides CC ( 717_718delCC) and position 873 difference lost nucleotide T (873delT). Note that position 873 is the position after alignment multiple sequences (blank/gap positions) were inserted (corresponding to position 733 of the sequence before alignment) (Figure 3.25). Figure 3.25. Analysis of distinct nucleotide regions/sites specific to P. trimera in the matK sequence
18 The analysis results s (Figure 3.25) showed that the matK gene had homogeneity among P. trimera species when analyzing the sequence details. Therefore, the matK gene can be used to identify P. trimera from other species in the same genus Paramignya. 3.4.5.3. Phân tích trình tự rbcL Tương tự, kết quả phân tích vùng trình tự rbcL gồm 570 nucleotide của các loài thuộc chi Paramignya đưa ra vùng trình tự chung. Tuy nhiên, trên toàn bộ chuỗi không phát hiện được vùng trình tự đặc thù riêng cho P. trimera. Kết quả được minh hoạ ở hình 3.26. Như vậy, không xác định được trình tự đặc thù để phát triển chỉ thị nhận dạng Xáo tam phân đối với trình tự rbcL. 3.4.5.4. rbcL sequence analysis Similarly, the analysis results of the rbcL sequence region consisting of 570 nucleotides of species of the genus Paramignya provide a common sequence region. However, on the whole sequence, no sequence region specific to P. trimera was detected. The result is illustrated in Figure 3.26. Thus, it is not possible to identify a specific sequence for the development DNA barcode to identify P. trimera from the rbcL sequence. Figure 3.26. Analysis of distinct nucleotide regions/sites specific to P. trimera in the rbcL sequence Table 3.5. Total ITS, matK and rbcL sequence regions different position from the analyzed species No. Barcode Size (nt) (after aligning multiple sequences) 1 ITS 715 109_110insCT; 130insC; 231insC/G; 266 insC 2 matK 774 703_704delAA; 717_718delCC; 873delT 3.4.6. Evaluation of DNA barcode based on barcode gap analysis To determine the developing a DNA marker as a DNA barcode sequence region, further analysis by ExcaliBAR program was performed to determine the species distance between the studied samples when analyzed by each selected sequence region. ITS, matK or rbcL and paired sequence (combining all three sequence regions above into one sequence). The results show that the intraspecific distance and interspecific distance correspond to the ITS, matK, rbcL sequences and the concatenated sequence of all three sequences ITS+matK+rbcL (concatenated sequence). are 0.11 ± 0.01, 0.29 ± 0.02, rbcL 0.48 ± 0.05 and 0.05 ± 0.0001, respectively (Table 3.6).