Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên
lượt xem 3
download
Bài viết Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên được nghiên cứu này nhằm xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis từ lợn nghi nhiễm bệnh thuộc địa bàn huyện Khoái Châu, Văn Giang, Yên Mỹ, tỉnh Hưng Yên.
Bình luận(0) Đăng nhập để gửi bình luận!
Nội dung Text: Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên
- Vietnam J. Agri. Sci. 2022, Vol. 20, No. 7: 911-919 Tạp chí Khoa học Nông nghiệp Việt Nam 2022, 20(7): 911-919 www.vnua.edu.vn Trương Quang Lâm*, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Phòng Thí nghiệm trọng điểm Công nghệ sinh học Thú y, Khoa Thú y, Học viện Nông nghiệp Việt Nam * Tác giả liên hệ: tqlam@vnua.edu.vn Ngày nhận bài: 12.10.2021 Ngày chấp nhận đăng: 05.07.2022 TÓM TẮT Mục tiêu của nghiên cứu này nhằm xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis từ lợn nghi nhiễm bệnh thuộc địa bàn huyện Khoái Châu, Văn Giang, Yên Mỹ, tỉnh Hưng Yên. Tổng số 52 mẫu bệnh phẩm của lợn nghi nhiễm bệnh đã được sử dụng để xác định tỷ lệ nhiễm vi khuẩn M. hyorhinis bằng phương pháp PCR. Kết quả nghiên cứu cho thấy tỷ lệ nhiễm vi khuẩn M. hyorhinis ở lợn nghi mắc bệnh tại 3 huyện ở tỉnh Hưng Yên tương đối cao chiếm tỷ lệ 26,92%, trong đó tỷ lệ nhiễm ở Khoái Châu 31,82%, Văn Giang 25,00% và Yên Mỹ 21,43%. Tỷ lệ nhiễm vi khuẩn M. hyorhinis trên lợn ở 5-10 tuần tuổi là cao nhất với 29,41% và tiếp theo là lợn > 10 tuần tuổi 28,57%, lợn < 5 tuần tuổi tỷ lệ nhiễm thấp nhất 21,43%. Nghiên cứu đã xác định tỷ lệ đồng nhiễm M. hyorhinis với M. hyopneumoniae chiếm 28,57%, H. parasuis 35,71% và S. suis 21,43%. Kết quả so sánh bệnh tích đại thể, sử dụng phương pháp PCR cho thấy lợn bệnh dương tính với vi khuẩn M. hyorhinis có đặc điểm bệnh lý điển hình với viêm dính màng ngoài phủ fibrin. Từ khóa: M. hyorhinis, tỷ lệ nhiễm, PCR, Hưng Yên. Exploring Prevalence of Mycoplasma hyorhinis Infection by PCR Method in Pigs Raised in Hung Yen Province ABSTRACT The aim of this study was to determine the infection rate of Mycoplasma hyorhinis from suspected pigs in Khoai Chau, Van Giang, and Yen My districts of Hung Yen province. A total of 52 clinical samples of suspected pigs were used to determine the infection rate of M. hyorhinis by using the PCR method. The results showed that the infection rate of M. hyorhinis in 3 districts in Hung Yen province was relatively high at 26.92%, in which infection rate was recorded in Khoai Chau with 31.82%, Van Giang 25.00% and Yen My 21.43%. The rate of infection with M. hyorhinis in pigs at 5-10 weeks of age was the highest at 29.41% and was similar to pigs >10 weeks old 28.57%, while pigs < 5 weeks old showed lowest infection rate 21.43%. Research also determined that the rate of co-infection of M. hyorhinis with M. hyopneumoniae accounted for 28.57%, H. parasuis 35.71% and S. suis 21.43%. Comparison of macroscopic findings and PCR results showed that pigs infected with M. hyorhinis exhibited the main pathological feature with a severe fibrinous pericarditis. Keywords: M. hyorhinis infection in pigs, prevalence, PCR, Hung Yen province. 911
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên 912
- Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh µ µ µ µ µ Phát hiện vi khuẩn Trình tự mồi Sản phẩm (bp) Tài liệu tham khảo M. hyopneumoniae ACTAGATAGGAAATGCTCTAG 430 Barate & cs., 2012 ATACTACTCAGGCGGATCATTTAAC H. parasuis GTGATGAGGAAGGGTGGTGT 821 Oliveira S & cs., 2001 GGCTTCGTCACCCTCTGTA S. suis GCAGCGTATTCTGTCAAACG 688 Okwumabua & cs., 2003 CCATGGACAGATAAAGATGG 913
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên Phát hiện Chu trình nhiệt của phản ứng PCR vi khuẩn Tiền biến tính Biến tính Bắt cặp Tổng hợp Kéo dài M. hyopneumoniae 94C/3 phút 94C/30 giây 50C/45 giây 72C/1 phút 72C/7 phút 1 chu kỳ 35 chu kỳ 1 chu kỳ H. parasuis 94C/5 phút 94C/30 giây 56C/1 phút 72C/90 giây 72C/7 phút 1 chu kỳ 30 chu kỳ 1 chu kỳ S. suis 94C/5 phút 94C/30 giây 57,3C/1phút 72C/90 giây 72C/6 phút 1 chu kỳ 30 chu kỳ 1 chu kỳ Huyện Số lợn kiểm tra Số lợn dương tính Tỷ lệ (%) Khoái Châu 22 7 31,82 Văn Giang 16 4 25,00 Yên Mỹ 14 3 21,43 Tổng 52 14 26,92 914
- Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Đối tượng lợn theo dõi Số lợn kiểm tra Số lợn dương tính Tỷ lệ (%) (tuần tuổi) 10 21 6 28,57 Tổng 52 14 26,92 915
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên Đối tượng lợn theo dõi M. hyorhinis M. hyopneumoniae H. parasuis S. suis (tuần tuổi) 10 6 1/6 2/6 1/6 (16,67%) (33,33%) (16,67%) Tổng 14 4/14 5/14 3/14 (28,57%) (35,71%) (21,43%) 916
- Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh 917
- Xác định tỷ lệ nhiễm vi khuẩn Mycoplasma hyorhinis ở lợn nuôi tại tỉnh Hưng Yên Abhijit K. Barate, Hwi-Young Lee, Hye-Won Jeong, Lam Quang Truong, Hong-Gu Joo & Tae-Wook Hahn (2012). An improved multiplex PCR for diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis. Korean Journal of Veterinary Research. 52(1):39-43. Boetner A.G., Binder M. & Bille-Hansen V. (1987). Streptococcus suis infections in Danish pigs and experimental infection with Streptococcus suis serotype 7. Acta Pathol Microbiol Immunol Scand B. 95: 233-239. Caron J., Ouardani M. & Dea S. (2000). Diagnosis and differentiation of Mycoplasma hyopneumoniae and Mycoplasma hyorhinis infections in pigs by PCR amplification of the p36 and p46 genes. J Clin Microbiol. 38: 1390-1396. 918
- Trương Quang Lâm, Nguyễn Thị Thu Hương, Nguyễn Thị Lan, Đào Lê Anh, Lê Thị Trang, Vũ Thị Ánh Gois M., Kuksa F. & Sisak F. (1977). Experimental and pathological lesions of Enzootic Pneumonia. infection of gnotobiotic piglets with Mycoplasma Vet Microbiol. 203: 1-5. hyorhinis and Bordetella bronchiseptica. Zentralbl Miranda-Morales R.E., Trejo V.R., López-Cerino Veterinarmed. B24: 89-96. L.E., Carrillo-Casas E.M., Sarmiento-Silva Huỳnh Thị Mỹ Lệ, Tạ Thị Kim Chung, Vũ Thị Ngọc, R.E., Trujillo-Ortega M.E., Figueroa R.B. Cao Thị Bích Phượng & Chu Thị Thanh Hương & Trigo-Tavera F.J. (2020). Frequency of (2018). Ứng dụng phản ứng Multiplex Nested PCR M. hyopneumoniae, M. hyorhinis and để phát hiện Haemophilus parasuis, Mycoplasma M. hyosynoviae in nasal and lung samples from hyorhinis và Streptococcus suis gây bệnh viêm đa pigs with symptoms of porcine enzootic thanh mạc ở lợn. Kỷ yếu Hội thảo khoa học nữ cán pneumonia. Revista Mexicana de Ciencias bộ viên chức. Nhà xuất bản Học viện Nông nghiệp. Pecuarias. 11(4): 946-960. tr. 167-175. Morita T., Ohiwa S., Shimada A., Kazama S., Kang I., Kim D., Han K., Seo H.W., Oh Y., Park C., Yagihashi T. & Umemura T. (1999). Intranasally Lee J., Gottschalk M. & Chae C. (2012). inoculated Mycoplasma hyorhinis causes Optimized protocol for multiplex nested eustachitis in pigs. Vet 82 Pathol. 36: 174-178. polymerase chain reaction to detect and differentiate Haemophilus parasuis, Streptococcus Morita T., Sasaki A., Kaji N., Shimada A., Kazama S., suis, and Mycoplasma hyorhinis in formalin-fixed, Yagihashi T., Umemura T. (1998). Induction of paraffin-embedded tissues from pigs with temporary otitis media in specific-pathogen-free polyserositis. Canadian Journal of Veterinary pigs by intratympanic inoculation of Mycoplasma Research. 76: 195-200. hyorhinis. Am J Vet Res. 59: 869-873. Lee J.A., Oh Y.R., Hwang M.A., Lee J.B., Park S.Y., Okwumabua O., O'Connor M. & Shull E. (2003). A Song C.S. & Lee S.W. (2016). Mycoplasma polymerase chain reaction (PCR) assay specific for hyorhinis is a potential pathogen of porcine Streptococcus suis based on the gene encoding the respiratory disease complex that aggravates glutamate dehydrogenase. FEMS Microbiol Lett. pneumonia caused by porcine reproductive and 218(1): 79-84. respiratory syndrome virus. Veterinary Oliveira S., Galina L. & Pijoan C. (2001). Immunology and Immunopathology. 177: 48-51. Development of a PCR test to diagnose Lin J.H., Chen S.P., Yeh K.S. & Weng C.N. (2006). Haemophilus parasuis infections. J Vet. Diagn Mycoplasma hyorhinis in Taiwan: Diagnosis and Invest. 13(6): 495-501. isolation of swine pneumonia pathogen. Vet Pallarés F.J., Halbur P.G., Schmitt C.S., Roth J.A., Microbiol. 115: 111-116. Opriessnig T., Thomas P.J., Kinyon J.M., Murphy Lobo E., Poveda C., Gupta R., Suarez A., Hernández D., Frank D.E. & Hoffman L.J. (2003). Y., Ramírez A. & Poveda J.B. (2011). Comparison of experimental models for Mycoplasmas hyorhinis in different regions of Streptococcus suis infection of conventional Cuba. Diagnosis. Braz J Microbiol. 42: 721-725. pigs. Canadian Journal of Veterinary Research. Luehrs A., Siegenthaler S., Grützner N., Grosse 67: 225-228. Beilage E., Kuhnert P. & Nathues H. (2017). Riley M.G., Russell E.G. & Callinan R.B. (1977). Occurrence of Mycoplasma hyorhinis infections in Haemophilus parasuis infection in swine. J Am fattening pigs and association with clinical signs Vet Med Assoc. 171(7):649-51. 919
CÓ THỂ BẠN MUỐN DOWNLOAD
-
Khảo sát tỷ lệ nhiễm và sự đề kháng kháng sinh của vi khuẩn Escherichia coli trên vịt tại tỉnh Đồng Tháp
8 p | 97 | 11
-
Thực trạng giết mổ, kiểm soát giết mổ và sự ô nhiễm vi khuẩn Salmonella, E. Coli trên thịt gà bán trên đại bàn thành phố Thái Nguyên
6 p | 98 | 4
-
Khảo sát tỷ lệ nhiễm và phân tích gen SSU RRNA của vi bào tử trùng gây bệnh trên tôm nuôi nước lợ
5 p | 45 | 4
-
Xác định tỷ lệ nhiễm và yếu tố độc lực của vi khuẩn Salmonella phân lập ở lợn nuôi tại huyện Hiệp Hòa, tỉnh Bắc Giang, Việt Nam
14 p | 46 | 4
-
Khảo sát tỷ lệ nhiễm và xác định gene kháng kháng sinh của Enterotoxigenic Escherichia coli trên heo con tiêu chảy tại tỉnh Vĩnh Long và Đồng Tháp
11 p | 31 | 3
-
Tỷ lệ nhiễm vi khuẩn E. coli và Salmonella trên thịt gia cầm sau khi giết mổ tại huyện Hữu Lũng - Lạng Sơn
5 p | 86 | 3
-
Tỷ lệ nhiễm vi khuẩn Yersinia enterocolitica trên lợn tại các cơ sở giết mổ ở địa bàn Hà Nội
9 p | 15 | 2
-
Xác định tỷ lệ nhiễm Streptococcus suis 2 ở lợn giết mổ trên địa bàn thành phố Huế và tạo dòng, biểu hiện gene mã hóa 6-phosphogluconate-dehydrogenase protein trong E. ColiBL21
9 p | 33 | 2
-
Tình hình nhiễm E. Coli sản sinh β-lactamaza (ESBL) tại một số cơ sở giết mổ lợn trên đại bàn thành phố Hà Nội
8 p | 51 | 2
-
Xác định khả năng sản sinh độc tố đường ruột của vi khuẩn Salmonella ssp, Staphylococcus aureus phân lập trên thịt lợn bán tại chợ ở một số tỉnh phía Bắc Việt Nam
8 p | 65 | 2
-
Tình hình nhiễm Salmonella trong chuỗi sản xuất thịt gà tại một số huyện của TP. Hà Nội 2014-2015
10 p | 61 | 2
-
Xác định tỉ lệ nhiễm và đặc tính sinh vật hóa học của một số vi khuẩn gây ngộ độc thực phẩm trên thịt lợn tươi bán tại chợ trên địa bàn các tỉnh miền Bắc Việt Nam
11 p | 88 | 1
-
Tình hình nhiễm Leptospira trên lợn nái tại Khánh Hòa
5 p | 52 | 1
-
Bệnh tích và tỉ lệ nhiễm một số vi khuẩn cộng nhiễm trên heo mắc hội chứng gầy còm sau cai sữa
7 p | 50 | 1
-
Kết quả phân lập và xác định tỷ lệ nhiễm Mycoplasma gallisepticum và Salmonella typhimurium ở vịt bằng kháng nguyên tự chế
6 p | 75 | 1
-
Sự lưu hành và đề kháng kháng sinh của vi khuẩn Pasteurella multocida phân lập từ dê nuôi tại thành phố Cần Thơ
11 p | 9 | 1
-
Đặc điểm kháng kháng sinh của vi khuẩn Streptococcus suis phân lập từ lợn bản địa nuôi trên địa bàn huyện A Lưới, tỉnh Thừa Thiên Huế
17 p | 7 | 1
Chịu trách nhiệm nội dung:
Nguyễn Công Hà - Giám đốc Công ty TNHH TÀI LIỆU TRỰC TUYẾN VI NA
LIÊN HỆ
Địa chỉ: P402, 54A Nơ Trang Long, Phường 14, Q.Bình Thạnh, TP.HCM
Hotline: 093 303 0098
Email: support@tailieu.vn